Mutagenetix > Incidental Mutation

Incidental Mutation 'R0346:Scel'

34296

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

038553-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0346 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103529984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 26 (Q26H)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000095576
AA Change: Q26H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: Q26H

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227322
AA Change: Q26H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,566,278	I4406L	probably damaging	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Add3	C	T	19: 53,216,956	R46*	probably null	Het
Alas1	A	T	9: 106,243,351	S82T	possibly damaging	Het
Alkbh5	C	G	11: 60,538,741	R107G	possibly damaging	Het
Ap3b1	A	T	13: 94,445,971	R365*	probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
AU021092	T	C	16: 5,216,854	D168G	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Caln1	C	A	5: 130,822,921	H184N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc191	T	C	16: 43,938,952	V372A	probably damaging	Het
Ccng2	T	G	5: 93,270,894	I126S	probably damaging	Het
Cep85	A	T	4: 134,132,422	N643K	probably damaging	Het
Clvs2	G	C	10: 33,622,546	S129R	possibly damaging	Het
Cntn1	G	T	15: 92,232,087		probably benign	Het
Cttn	A	T	7: 144,452,539		probably benign	Het
Dedd2	T	C	7: 25,211,269	S161G	possibly damaging	Het
Dnajb13	T	C	7: 100,503,925	D263G	probably damaging	Het
Dppa4	T	A	16: 48,289,324		probably benign	Het
Ear2	A	G	14: 44,102,906	E7G	probably damaging	Het
Eif2b4	A	G	5: 31,188,108		probably benign	Het
Etl4	G	T	2: 20,759,652		probably null	Het
Fbxo15	T	A	18: 84,960,221		probably null	Het
Gm8765	T	C	13: 50,703,310	Y995H	probably benign	Het
Gm9970	A	G	5: 31,240,838		probably benign	Het
Hap1	A	G	11: 100,356,029	S17P	probably benign	Het
Hgd	C	T	16: 37,588,774		probably benign	Het
Inpp5f	T	A	7: 128,690,668	L16Q	probably damaging	Het
Islr2	G	A	9: 58,198,343	R545*	probably null	Het
Itgav	G	T	2: 83,792,609	C675F	probably damaging	Het
Kif13a	T	A	13: 46,814,219	I403L	possibly damaging	Het
Kif14	T	A	1: 136,468,160	I68N	probably damaging	Het
Kif26a	G	T	12: 112,179,348	K1764N	probably null	Het
Lrrd1	C	A	5: 3,850,215	F173L	probably benign	Het
Mroh4	G	C	15: 74,614,292		probably benign	Het
Mrvi1	T	C	7: 110,898,976	D404G	probably damaging	Het
Msh5	A	G	17: 35,029,888	V723A	probably benign	Het
Mybph	T	G	1: 134,197,754	I279S	probably damaging	Het
Myh4	A	T	11: 67,260,326	I1936L	probably benign	Het
Myo1h	A	T	5: 114,355,209	T704S	probably benign	Het
Nav2	C	A	7: 49,604,585	T2377K	probably benign	Het
Nipbl	T	G	15: 8,360,956	Q276H	probably damaging	Het
Nlrp9b	T	C	7: 20,024,515	L559P	probably damaging	Het
Nup210l	T	A	3: 90,189,438	V1318E	probably damaging	Het
Olfr1427	A	T	19: 12,099,439	S67T	probably damaging	Het
Olfr18	A	G	9: 20,314,411	S170P	probably benign	Het
Olfr385	A	G	11: 73,589,457	Y94H	probably damaging	Het
Olfr765	C	A	10: 129,046,473	V197F	possibly damaging	Het
P2ry13	T	C	3: 59,209,566	T264A	possibly damaging	Het
Plekhg5	T	C	4: 152,114,253	L966P	probably benign	Het
Prss35	A	G	9: 86,755,351	K58R	probably benign	Het
Ptafr	T	A	4: 132,580,079	L260*	probably null	Het
Pum1	A	T	4: 130,779,805	T1157S	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf145	A	G	11: 44,555,164	Y275C	probably damaging	Het
Rpl6	A	T	5: 121,208,491	K218N	possibly damaging	Het
Rps6	T	C	4: 86,855,981	T128A	probably benign	Het
Ryr1	G	T	7: 29,067,588		probably benign	Het
Sfxn4	A	T	19: 60,858,673	D57E	probably benign	Het
Slc35d1	A	C	4: 103,190,847	L240R	probably damaging	Het
Smcr8	A	G	11: 60,779,750	I575V	probably benign	Het
Syk	G	A	13: 52,640,659	M476I	probably damaging	Het
Tbcel	A	T	9: 42,437,243		probably benign	Het
Tob2	C	A	15: 81,858,223	G65W	probably damaging	Het
Trim16	A	G	11: 62,840,694	N464D	probably benign	Het
Trim36	T	C	18: 46,199,709		probably benign	Het
Trpv4	C	A	5: 114,630,529		probably benign	Het
Tsga10	T	A	1: 37,840,519	T64S	possibly damaging	Het
Ttc26	T	C	6: 38,409,435	C364R	probably damaging	Het
Vars2	A	T	17: 35,664,864		probably benign	Het
Vmn1r72	C	A	7: 11,669,694	V276L	probably benign	Het
Vps13a	T	A	19: 16,677,969	K1898N	probably benign	Het
Vps18	A	G	2: 119,297,164	M823V	probably damaging	Het
Washc2	T	C	6: 116,220,523		probably benign	Het
Zfp763	A	T	17: 33,019,747	H141Q	probably benign	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GGTTTGCCTCAGCCTGATGATCCT -3'
(R):5'- GGCTGTATCTTCCAAACAGAGATGCCT -3'

Sequencing Primer
(F):5'- TTCAGTTGGCACCTGAGCAG -3'
(R):5'- GAGATGCCTCCATCCAACTATATC -3'

Posted On

2013-05-09