Incidental Mutation 'R0346:Nipbl'
ID 34297
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4921518A06Rik, 4933421G18Rik
MMRRC Submission 038553-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R0346 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8290617-8444463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 8360956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 276 (Q276H)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: Q276H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: Q276H

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R3620_nipbl_616 UTSW 15 8333024 missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
R8854:Nipbl UTSW 15 8300726 missense probably damaging 1.00
R8887:Nipbl UTSW 15 8361787 missense probably damaging 1.00
R8942:Nipbl UTSW 15 8351620 missense probably benign
R8991:Nipbl UTSW 15 8291513 missense probably damaging 1.00
R9008:Nipbl UTSW 15 8327124 missense probably damaging 1.00
R9070:Nipbl UTSW 15 8338731 missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8350856 missense probably benign 0.00
R9622:Nipbl UTSW 15 8336889 missense probably benign 0.27
R9778:Nipbl UTSW 15 8291548 missense probably benign 0.10
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTAAATCCCTTTTCAGGAGGTGC -3'
(R):5'- ACGCTGCCCTCAGACATTTATGG -3'

Sequencing Primer
(F):5'- GCACAGTTGAGTCTGATTAAACAG -3'
(R):5'- CATTGCCATGCATAGGCTG -3'
Posted On 2013-05-09