Incidental Mutation 'R4559:Il20ra'
ID 342997
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission 041785-MU
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4559 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19749284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 104 (T104A)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably damaging
Transcript: ENSMUST00000020185
AA Change: T104A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: T104A

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Meta Mutation Damage Score 0.5845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
1700066M21Rik T C 1: 57,382,924 F153S possibly damaging Het
Acss1 A G 2: 150,638,485 V222A probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Atxn10 A G 15: 85,438,120 I398V possibly damaging Het
Cep192 T A 18: 67,871,513 C2312S probably damaging Het
Cidea C T 18: 67,360,228 Q106* probably null Het
Cnga4 A G 7: 105,405,685 T159A probably damaging Het
Cyp2j12 G T 4: 96,112,957 S304R probably damaging Het
Dsg4 T A 18: 20,470,921 V815E probably damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Farp1 T C 14: 121,272,801 M737T probably damaging Het
Fbn1 T A 2: 125,351,714 D1395V possibly damaging Het
Fbn2 C T 18: 58,076,074 M1076I probably benign Het
Fitm2 T A 2: 163,472,673 probably benign Het
Fras1 A G 5: 96,781,289 R3851G probably damaging Het
Frem2 C T 3: 53,654,321 V922I probably benign Het
Gm10719 A T 9: 3,018,945 T200S probably benign Het
Grin3a T C 4: 49,844,555 D176G probably damaging Het
Hdac5 T C 11: 102,199,102 probably benign Het
Ift140 C A 17: 25,090,767 H1090Q probably damaging Het
Il22ra2 A G 10: 19,626,712 D93G possibly damaging Het
Ing1 A G 8: 11,562,090 K176R probably benign Het
Jph1 A T 1: 17,004,511 C428S probably benign Het
Kif13b G T 14: 64,806,132 G1794W probably damaging Het
Map10 A G 8: 125,671,814 T649A probably benign Het
Med12l T C 3: 59,007,102 probably null Het
Nat8f1 A G 6: 85,910,585 I131T probably benign Het
Oas1d C A 5: 120,916,895 Q177K probably benign Het
Olfr1247 C A 2: 89,609,699 M134I probably damaging Het
Olfr635 G A 7: 103,979,560 D123N probably damaging Het
P2ry2 A G 7: 100,998,156 V314A possibly damaging Het
Pfkl G T 10: 77,988,883 R691S probably benign Het
Plb1 T A 5: 32,332,831 I1005N probably damaging Het
Prkacb A G 3: 146,745,392 probably benign Het
Ptprm A T 17: 66,683,408 Y1412N possibly damaging Het
Rab22a A G 2: 173,661,433 D13G probably damaging Het
Rab29 G A 1: 131,872,567 W201* probably null Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Rassf10 A G 7: 112,955,131 E313G probably benign Het
Sf1 GGCAGCAGCAGCAGCAGCAGC GGCAGCAGCAGCAGCAGC 19: 6,374,815 probably benign Het
Sipa1l3 A T 7: 29,332,253 L468Q probably damaging Het
Slc17a1 A T 13: 23,878,712 K254* probably null Het
Slc6a12 G A 6: 121,363,861 probably null Het
Slfn8 A G 11: 83,004,744 L412P probably damaging Het
St5 A G 7: 109,525,578 F665L probably damaging Het
Taf4b T C 18: 14,813,526 S469P probably damaging Het
Tgoln1 T C 6: 72,615,681 E272G probably damaging Het
Tlr12 C A 4: 128,615,770 G896W probably damaging Het
Tnfrsf1a A G 6: 125,360,766 I229V probably benign Het
Ttn G A 2: 76,919,546 H3720Y probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1436:Il20ra UTSW 10 19749252 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19749359 missense probably damaging 0.99
R6543:Il20ra UTSW 10 19749323 missense probably damaging 1.00
R6755:Il20ra UTSW 10 19750794 missense probably benign 0.15
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19759616 missense probably benign 0.21
R9439:Il20ra UTSW 10 19743003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAACAGCAAAAGTGGATCTG -3'
(R):5'- AGTTGCCTATGAGGACAGAATATC -3'

Sequencing Primer
(F):5'- GCATCTGTGTTTTGCTGAAGACAAAG -3'
(R):5'- TGCCTATGAGGACAGAATATCATACC -3'
Posted On 2015-09-24