Incidental Mutation 'R4559:Taf4b'
ID 343009
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission 041785-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R4559 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 14783245-14900359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14813526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 469 (S469P)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: S469P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: S469P

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Meta Mutation Damage Score 0.1356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
1700066M21Rik T C 1: 57,382,924 F153S possibly damaging Het
Acss1 A G 2: 150,638,485 V222A probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Atxn10 A G 15: 85,438,120 I398V possibly damaging Het
Cep192 T A 18: 67,871,513 C2312S probably damaging Het
Cidea C T 18: 67,360,228 Q106* probably null Het
Cnga4 A G 7: 105,405,685 T159A probably damaging Het
Cyp2j12 G T 4: 96,112,957 S304R probably damaging Het
Dsg4 T A 18: 20,470,921 V815E probably damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Farp1 T C 14: 121,272,801 M737T probably damaging Het
Fbn1 T A 2: 125,351,714 D1395V possibly damaging Het
Fbn2 C T 18: 58,076,074 M1076I probably benign Het
Fitm2 T A 2: 163,472,673 probably benign Het
Fras1 A G 5: 96,781,289 R3851G probably damaging Het
Frem2 C T 3: 53,654,321 V922I probably benign Het
Gm10719 A T 9: 3,018,945 T200S probably benign Het
Grin3a T C 4: 49,844,555 D176G probably damaging Het
Hdac5 T C 11: 102,199,102 probably benign Het
Ift140 C A 17: 25,090,767 H1090Q probably damaging Het
Il20ra A G 10: 19,749,284 T104A probably damaging Het
Il22ra2 A G 10: 19,626,712 D93G possibly damaging Het
Ing1 A G 8: 11,562,090 K176R probably benign Het
Jph1 A T 1: 17,004,511 C428S probably benign Het
Kif13b G T 14: 64,806,132 G1794W probably damaging Het
Map10 A G 8: 125,671,814 T649A probably benign Het
Med12l T C 3: 59,007,102 probably null Het
Nat8f1 A G 6: 85,910,585 I131T probably benign Het
Oas1d C A 5: 120,916,895 Q177K probably benign Het
Olfr1247 C A 2: 89,609,699 M134I probably damaging Het
Olfr635 G A 7: 103,979,560 D123N probably damaging Het
P2ry2 A G 7: 100,998,156 V314A possibly damaging Het
Pfkl G T 10: 77,988,883 R691S probably benign Het
Plb1 T A 5: 32,332,831 I1005N probably damaging Het
Prkacb A G 3: 146,745,392 probably benign Het
Ptprm A T 17: 66,683,408 Y1412N possibly damaging Het
Rab22a A G 2: 173,661,433 D13G probably damaging Het
Rab29 G A 1: 131,872,567 W201* probably null Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Rassf10 A G 7: 112,955,131 E313G probably benign Het
Sf1 GGCAGCAGCAGCAGCAGCAGC GGCAGCAGCAGCAGCAGC 19: 6,374,815 probably benign Het
Sipa1l3 A T 7: 29,332,253 L468Q probably damaging Het
Slc17a1 A T 13: 23,878,712 K254* probably null Het
Slc6a12 G A 6: 121,363,861 probably null Het
Slfn8 A G 11: 83,004,744 L412P probably damaging Het
St5 A G 7: 109,525,578 F665L probably damaging Het
Tgoln1 T C 6: 72,615,681 E272G probably damaging Het
Tlr12 C A 4: 128,615,770 G896W probably damaging Het
Tnfrsf1a A G 6: 125,360,766 I229V probably benign Het
Ttn G A 2: 76,919,546 H3720Y probably benign Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
R8535:Taf4b UTSW 18 14822138 missense probably damaging 0.99
R8772:Taf4b UTSW 18 14835852 missense probably damaging 1.00
R8805:Taf4b UTSW 18 14813428 missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14830070 missense probably benign 0.39
R9155:Taf4b UTSW 18 14813239 missense probably benign 0.00
R9254:Taf4b UTSW 18 14813374 missense probably damaging 0.98
R9338:Taf4b UTSW 18 14821498 missense probably benign 0.00
R9379:Taf4b UTSW 18 14813374 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGCTGGTCCAGGAGTAG -3'
(R):5'- TGGTACTCACTAGTTGCTTGAC -3'

Sequencing Primer
(F):5'- ACACTGGAGTTGTGACACTGC -3'
(R):5'- ACTCACTAGTTGCTTGACTTTGG -3'
Posted On 2015-09-24