Incidental Mutation 'R4559:Dsg4'
ID343010
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 041785-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R4559 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20470921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 815 (V815E)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: V815E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: V815E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.1766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
1700066M21Rik T C 1: 57,382,924 F153S possibly damaging Het
Acss1 A G 2: 150,638,485 V222A probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Atxn10 A G 15: 85,438,120 I398V possibly damaging Het
Cep192 T A 18: 67,871,513 C2312S probably damaging Het
Cidea C T 18: 67,360,228 Q106* probably null Het
Cnga4 A G 7: 105,405,685 T159A probably damaging Het
Cyp2j12 G T 4: 96,112,957 S304R probably damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Farp1 T C 14: 121,272,801 M737T probably damaging Het
Fbn1 T A 2: 125,351,714 D1395V possibly damaging Het
Fbn2 C T 18: 58,076,074 M1076I probably benign Het
Fitm2 T A 2: 163,472,673 probably benign Het
Fras1 A G 5: 96,781,289 R3851G probably damaging Het
Frem2 C T 3: 53,654,321 V922I probably benign Het
Gm10719 A T 9: 3,018,945 T200S probably benign Het
Grin3a T C 4: 49,844,555 D176G probably damaging Het
Hdac5 T C 11: 102,199,102 probably benign Het
Ift140 C A 17: 25,090,767 H1090Q probably damaging Het
Il20ra A G 10: 19,749,284 T104A probably damaging Het
Il22ra2 A G 10: 19,626,712 D93G possibly damaging Het
Ing1 A G 8: 11,562,090 K176R probably benign Het
Jph1 A T 1: 17,004,511 C428S probably benign Het
Kif13b G T 14: 64,806,132 G1794W probably damaging Het
Map10 A G 8: 125,671,814 T649A probably benign Het
Med12l T C 3: 59,007,102 probably null Het
Nat8f1 A G 6: 85,910,585 I131T probably benign Het
Oas1d C A 5: 120,916,895 Q177K probably benign Het
Olfr1247 C A 2: 89,609,699 M134I probably damaging Het
Olfr635 G A 7: 103,979,560 D123N probably damaging Het
P2ry2 A G 7: 100,998,156 V314A possibly damaging Het
Pfkl G T 10: 77,988,883 R691S probably benign Het
Plb1 T A 5: 32,332,831 I1005N probably damaging Het
Prkacb A G 3: 146,745,392 probably benign Het
Ptprm A T 17: 66,683,408 Y1412N possibly damaging Het
Rab22a A G 2: 173,661,433 D13G probably damaging Het
Rab29 G A 1: 131,872,567 W201* probably null Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Rassf10 A G 7: 112,955,131 E313G probably benign Het
Sf1 GGCAGCAGCAGCAGCAGCAGC GGCAGCAGCAGCAGCAGC 19: 6,374,815 probably benign Het
Sipa1l3 A T 7: 29,332,253 L468Q probably damaging Het
Slc17a1 A T 13: 23,878,712 K254* probably null Het
Slc6a12 G A 6: 121,363,861 probably null Het
Slfn8 A G 11: 83,004,744 L412P probably damaging Het
St5 A G 7: 109,525,578 F665L probably damaging Het
Taf4b T C 18: 14,813,526 S469P probably damaging Het
Tgoln1 T C 6: 72,615,681 E272G probably damaging Het
Tlr12 C A 4: 128,615,770 G896W probably damaging Het
Tnfrsf1a A G 6: 125,360,766 I229V probably benign Het
Ttn G A 2: 76,919,546 H3720Y probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGTCAGAGAAGTCACTGAAGC -3'
(R):5'- CCTCTGAGAGAGTCATTCCTGAAG -3'

Sequencing Primer
(F):5'- GAAGCACAGTTATTACTTCTCTCTGG -3'
(R):5'- GAGTCATTCCTGAAGACTCATTGAC -3'
Posted On2015-09-24