Incidental Mutation 'R4560:Scg2'
ID 343020
Institutional Source Beutler Lab
Gene Symbol Scg2
Ensembl Gene ENSMUSG00000050711
Gene Name secretogranin II
Synonyms SgII, Chgc
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4560 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 79434669-79440120 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79435181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 568 (H568Q)
Ref Sequence ENSEMBL: ENSMUSP00000139740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]
AlphaFold Q03517
Predicted Effect probably damaging
Transcript: ENSMUST00000049972
AA Change: H608Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: H608Q

DomainStartEndE-ValueType
Pfam:Granin 27 614 7.2e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185234
AA Change: H568Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: H568Q

DomainStartEndE-ValueType
Pfam:Granin 27 319 1.4e-123 PFAM
Pfam:Granin 316 574 7.1e-91 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,757 S750P probably damaging Het
Adcy4 A C 14: 55,778,950 probably null Het
Atp8b1 A T 18: 64,556,879 L594* probably null Het
Atp8b1 C T 18: 64,568,247 V347I probably benign Het
Axin1 A G 17: 26,173,771 D342G probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Cog8 A T 8: 107,052,211 probably null Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Trim9 A C 12: 70,347,118 Y17* probably null Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Zfp952 A G 17: 33,003,954 H469R probably benign Het
Other mutations in Scg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Scg2 APN 1 79436821 missense probably benign 0.16
IGL02083:Scg2 APN 1 79436224 missense probably benign 0.00
IGL02316:Scg2 APN 1 79435681 missense probably damaging 1.00
IGL02338:Scg2 APN 1 79436493 missense possibly damaging 0.93
R0281:Scg2 UTSW 1 79435512 missense possibly damaging 0.95
R0384:Scg2 UTSW 1 79435549 missense probably benign 0.42
R0501:Scg2 UTSW 1 79435603 missense probably damaging 1.00
R0909:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R1773:Scg2 UTSW 1 79435635 missense probably benign 0.04
R2254:Scg2 UTSW 1 79436500 missense probably damaging 1.00
R4074:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4076:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4097:Scg2 UTSW 1 79435821 missense probably damaging 0.99
R4621:Scg2 UTSW 1 79436664 missense probably benign 0.08
R4876:Scg2 UTSW 1 79435919 missense probably damaging 1.00
R4944:Scg2 UTSW 1 79436476 nonsense probably null
R5829:Scg2 UTSW 1 79436920 missense probably damaging 1.00
R6158:Scg2 UTSW 1 79435400 missense probably damaging 1.00
R6248:Scg2 UTSW 1 79436306 missense probably benign 0.29
R6365:Scg2 UTSW 1 79435300 missense probably benign
R6459:Scg2 UTSW 1 79436290 missense probably damaging 1.00
R6676:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R6693:Scg2 UTSW 1 79436020 missense probably benign 0.01
R7259:Scg2 UTSW 1 79436985 missense probably benign
R7393:Scg2 UTSW 1 79435231 missense probably damaging 1.00
R7578:Scg2 UTSW 1 79436895 missense probably damaging 0.99
R7608:Scg2 UTSW 1 79436181 missense probably benign 0.00
R8166:Scg2 UTSW 1 79435583 missense possibly damaging 0.56
R8247:Scg2 UTSW 1 79436519 missense possibly damaging 0.92
R8296:Scg2 UTSW 1 79435505 missense probably benign 0.13
R8308:Scg2 UTSW 1 79436859 missense probably benign 0.18
R8789:Scg2 UTSW 1 79435783 missense probably benign 0.05
R9252:Scg2 UTSW 1 79436352 missense probably damaging 0.98
R9286:Scg2 UTSW 1 79435936 missense probably damaging 1.00
R9489:Scg2 UTSW 1 79435219 missense probably damaging 1.00
R9605:Scg2 UTSW 1 79435219 missense probably damaging 1.00
Z1176:Scg2 UTSW 1 79436789 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCCAAAATGACCTGGAGTC -3'
(R):5'- CAACCAGCTGAAGAGAGTGC -3'

Sequencing Primer
(F):5'- GACCTGGAGTCATCTGCCTATAC -3'
(R):5'- CCATCAAGGAACATCTGGGGC -3'
Posted On 2015-09-24