Mutagenetix > Incidental Mutation

Incidental Mutation 'R4560:Ikbke'

343022

Institutional Source

Beutler Lab

Gene Symbol

Ikbke

Ensembl Gene

ENSMUSG00000042349

Gene Name

inhibitor of kappaB kinase epsilon

Synonyms

IKK-i, IKKepsilon

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131254343-131279606 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 131272120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 243 (C243Y)

Ref Sequence

ENSEMBL: ENSMUSP00000124190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062108] [ENSMUST00000159195] [ENSMUST00000161764]

AlphaFold

Q9R0T8

Predicted Effect

probably damaging
Transcript: ENSMUST00000062108
AA Change: C267Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054126
Gene: ENSMUSG00000042349
AA Change: C267Y

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	9	249	1.1e-29	PFAM
Pfam:Pkinase	9	301	6.7e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159195

SMART Domains

Protein: ENSMUSP00000124486
Gene: ENSMUSG00000042349

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	130	2.2e-23	PFAM
Pfam:Pkinase_Tyr	9	130	2.1e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161764
AA Change: C243Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124190
Gene: ENSMUSG00000042349
AA Change: C243Y

Domain	Start	End	E-Value	Type
Pfam:Pkinase	49	278	9.3e-31	PFAM
Pfam:Pkinase_Tyr	50	226	5.7e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163029

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,741,757	S750P	probably damaging	Het
Adcy4	A	C	14: 55,778,950		probably null	Het
Atp8b1	A	T	18: 64,556,879	L594*	probably null	Het
Atp8b1	C	T	18: 64,568,247	V347I	probably benign	Het
Axin1	A	G	17: 26,173,771	D342G	probably damaging	Het
Bace2	G	A	16: 97,421,980	R368Q	probably damaging	Het
Capn10	T	C	1: 92,939,362	Y105H	probably damaging	Het
Ccdc89	T	G	7: 90,427,128	L182R	probably damaging	Het
Cdk5rap2	A	G	4: 70,315,331	F537S	probably benign	Het
Cidec	A	T	6: 113,428,438	M118K	probably damaging	Het
Cog8	A	T	8: 107,052,211		probably null	Het
Ctif	A	T	18: 75,519,881	L435Q	probably damaging	Het
Dhx9	A	G	1: 153,467,157	V533A	probably damaging	Het
Drc1	T	A	5: 30,363,097	M594K	probably benign	Het
Dthd1	C	T	5: 62,827,092	T380I	probably damaging	Het
Fat2	A	G	11: 55,265,951	S3475P	possibly damaging	Het
G6pd2	G	A	5: 61,810,343	R487H	possibly damaging	Het
Hcrtr2	A	G	9: 76,254,688	V140A	probably damaging	Het
Il21	C	A	3: 37,225,484	E128*	probably null	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Me3	G	T	7: 89,849,730	R506L	probably benign	Het
Mtf2	T	A	5: 108,086,989		probably null	Het
Nbas	A	G	12: 13,583,527	N2311S	probably benign	Het
Nomo1	G	T	7: 46,041,480	V97L	probably damaging	Het
Pcdhb11	G	A	18: 37,423,734	V706I	possibly damaging	Het
Pkhd1	G	A	1: 20,211,858	R2920C	probably damaging	Het
Prox2	T	C	12: 85,095,043	T129A	probably benign	Het
Rgs18	T	G	1: 144,755,982	I131L	probably benign	Het
Rnf19b	G	T	4: 129,071,823	C57F	probably damaging	Het
Rpl11	T	C	4: 136,051,211	Y122C	probably damaging	Het
Sarnp	A	G	10: 128,846,543	K5R	probably damaging	Het
Scg2	A	T	1: 79,435,181	H568Q	probably damaging	Het
Sept10	T	C	10: 59,183,595	Y150C	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Smco2	T	A	6: 146,871,176	V292D	possibly damaging	Het
Smok3c	A	G	5: 138,064,484	M78V	probably benign	Het
Spag16	C	A	1: 69,844,296	F61L	probably benign	Het
Spata22	G	A	11: 73,345,759	R297H	probably damaging	Het
Syt3	C	A	7: 44,395,944	P536Q	probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Trim9	A	C	12: 70,347,118	Y17*	probably null	Het
Tsga10	A	G	1: 37,807,082	M321T	probably benign	Het
Ttc13	A	G	8: 124,675,277	L657P	probably damaging	Het
Ubxn1	C	T	19: 8,874,224	T207I	probably benign	Het
Vmn2r117	A	T	17: 23,459,877	V791D	probably damaging	Het
Vps54	C	G	11: 21,312,260	C785W	possibly damaging	Het
Zfp616	A	G	11: 74,083,034	D43G	probably benign	Het
Zfp952	A	G	17: 33,003,954	H469R	probably benign	Het

Other mutations in Ikbke

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ikbke	APN	1	131270012	splice site	probably null
IGL00703:Ikbke	APN	1	131255302	utr 3 prime	probably benign
IGL01079:Ikbke	APN	1	131265647	missense	possibly damaging	0.64
IGL01106:Ikbke	APN	1	131260055	splice site	probably benign
IGL01336:Ikbke	APN	1	131273756	missense	probably damaging	1.00
IGL01505:Ikbke	APN	1	131255311	missense	probably benign	0.00
IGL01564:Ikbke	APN	1	131257921	missense	probably benign	0.37
IGL01568:Ikbke	APN	1	131257896	splice site	probably null
IGL01668:Ikbke	APN	1	131256938	missense	probably benign	0.05
IGL01977:Ikbke	APN	1	131272101	splice site	probably benign
IGL02162:Ikbke	APN	1	131273715	missense	possibly damaging	0.69
IGL02653:Ikbke	APN	1	131271835	missense	possibly damaging	0.89
IGL02859:Ikbke	APN	1	131270197	missense	probably damaging	0.97
triathelon	UTSW	1	131275267	frame shift	probably null
R0028:Ikbke	UTSW	1	131272184	missense	possibly damaging	0.87
R0427:Ikbke	UTSW	1	131257910	missense	possibly damaging	0.62
R0607:Ikbke	UTSW	1	131270184	critical splice donor site	probably null
R1295:Ikbke	UTSW	1	131270226	missense	probably benign	0.03
R1470:Ikbke	UTSW	1	131276487	missense	probably null	1.00
R1470:Ikbke	UTSW	1	131276487	missense	probably null	1.00
R1720:Ikbke	UTSW	1	131259210	missense	possibly damaging	0.94
R1728:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1728:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1729:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1729:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1730:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1730:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1739:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1739:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1748:Ikbke	UTSW	1	131259200	missense	probably benign	0.02
R1762:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1762:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1763:Ikbke	UTSW	1	131265877	missense	probably benign	0.01
R1783:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1783:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1784:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1784:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1785:Ikbke	UTSW	1	131265937	missense	probably benign	0.01
R1785:Ikbke	UTSW	1	131269823	missense	probably benign	0.00
R1794:Ikbke	UTSW	1	131259218	missense	probably damaging	1.00
R2143:Ikbke	UTSW	1	131273474	missense	probably damaging	0.98
R2144:Ikbke	UTSW	1	131273474	missense	probably damaging	0.98
R2145:Ikbke	UTSW	1	131273474	missense	probably damaging	0.98
R2386:Ikbke	UTSW	1	131259266	missense	probably damaging	1.00
R2893:Ikbke	UTSW	1	131270224	missense	probably damaging	1.00
R4210:Ikbke	UTSW	1	131263348	missense	probably damaging	0.97
R4211:Ikbke	UTSW	1	131263348	missense	probably damaging	0.97
R4284:Ikbke	UTSW	1	131275778	critical splice donor site	probably null
R4461:Ikbke	UTSW	1	131265922	missense	probably benign
R4551:Ikbke	UTSW	1	131258033	intron	probably benign
R4849:Ikbke	UTSW	1	131275267	frame shift	probably null
R4855:Ikbke	UTSW	1	131257111	splice site	probably null
R4876:Ikbke	UTSW	1	131275267	frame shift	probably null
R4879:Ikbke	UTSW	1	131275267	frame shift	probably null
R4967:Ikbke	UTSW	1	131275267	frame shift	probably null
R4968:Ikbke	UTSW	1	131275267	frame shift	probably null
R4971:Ikbke	UTSW	1	131275267	frame shift	probably null
R5020:Ikbke	UTSW	1	131273660	missense	probably damaging	1.00
R5699:Ikbke	UTSW	1	131276467	critical splice donor site	probably null
R5814:Ikbke	UTSW	1	131271779	missense	probably damaging	0.96
R6392:Ikbke	UTSW	1	131275146	splice site	probably null
R6492:Ikbke	UTSW	1	131259218	missense	probably damaging	1.00
R6899:Ikbke	UTSW	1	131275762	missense	probably damaging	1.00
R7552:Ikbke	UTSW	1	131272150	nonsense	probably null
R7583:Ikbke	UTSW	1	131276479	missense	probably damaging	0.99
R7652:Ikbke	UTSW	1	131271832	missense	probably damaging	1.00
R7806:Ikbke	UTSW	1	131271898	missense	probably damaging	1.00
R7984:Ikbke	UTSW	1	131275786	missense	probably null	1.00
R8211:Ikbke	UTSW	1	131271778	missense	probably damaging	0.96
R8309:Ikbke	UTSW	1	131263328	nonsense	probably null
R9012:Ikbke	UTSW	1	131273453	missense	probably damaging	0.97
R9176:Ikbke	UTSW	1	131263288	missense	probably benign	0.01
R9466:Ikbke	UTSW	1	131265708	missense	probably damaging	0.96
R9483:Ikbke	UTSW	1	131270982	missense	probably damaging	1.00
R9643:Ikbke	UTSW	1	131259285	critical splice acceptor site	probably null
X0026:Ikbke	UTSW	1	131257986	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTTCCACCTCCAGGATGTTGG -3'
(R):5'- TGGCTGAGTGACATGGACTG -3'

Sequencing Primer
(F):5'- CTCCAGGATGTTGGCCAGGATG -3'
(R):5'- CTGAGTGACATGGACTGTGATG -3'

Posted On

2015-09-24