Incidental Mutation 'R4560:Dhx9'
ID 343025
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene Name DExH-box helicase 9
Synonyms Ddx9, NDHII, nuclear DNA helicase II, leukophysin, NDH II, RNA helicase, RHA
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4560 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 153331504-153363406 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153342903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 533 (V533A)
Ref Sequence ENSEMBL: ENSMUSP00000038135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042141
AA Change: V533A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: V533A

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186380
AA Change: V532A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: V532A

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000188345
AA Change: V533A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: V533A

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A C 14: 56,016,407 (GRCm39) probably null Het
Atp8b1 A T 18: 64,689,950 (GRCm39) L594* probably null Het
Atp8b1 C T 18: 64,701,318 (GRCm39) V347I probably benign Het
Axin1 A G 17: 26,392,745 (GRCm39) D342G probably damaging Het
Bace2 G A 16: 97,223,180 (GRCm39) R368Q probably damaging Het
Capn10 T C 1: 92,867,084 (GRCm39) Y105H probably damaging Het
Ccdc89 T G 7: 90,076,336 (GRCm39) L182R probably damaging Het
Cdk5rap2 A G 4: 70,233,568 (GRCm39) F537S probably benign Het
Cidec A T 6: 113,405,399 (GRCm39) M118K probably damaging Het
Cog8 A T 8: 107,778,843 (GRCm39) probably null Het
Ctif A T 18: 75,652,952 (GRCm39) L435Q probably damaging Het
Drc1 T A 5: 30,520,441 (GRCm39) M594K probably benign Het
Dthd1 C T 5: 62,984,435 (GRCm39) T380I probably damaging Het
Fat2 A G 11: 55,156,777 (GRCm39) S3475P possibly damaging Het
G6pd2 G A 5: 61,967,686 (GRCm39) R487H possibly damaging Het
Hcrtr2 A G 9: 76,161,970 (GRCm39) V140A probably damaging Het
Ikbke C T 1: 131,199,857 (GRCm39) C243Y probably damaging Het
Il21 C A 3: 37,279,633 (GRCm39) E128* probably null Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Me3 G T 7: 89,498,938 (GRCm39) R506L probably benign Het
Mtf2 T A 5: 108,234,855 (GRCm39) probably null Het
Nbas A G 12: 13,633,528 (GRCm39) N2311S probably benign Het
Nomo1 G T 7: 45,690,904 (GRCm39) V97L probably damaging Het
Pcdhb11 G A 18: 37,556,787 (GRCm39) V706I possibly damaging Het
Pkhd1 G A 1: 20,282,082 (GRCm39) R2920C probably damaging Het
Prox2 T C 12: 85,141,817 (GRCm39) T129A probably benign Het
Rgs18 T G 1: 144,631,720 (GRCm39) I131L probably benign Het
Rnf19b G T 4: 128,965,616 (GRCm39) C57F probably damaging Het
Rpl11 T C 4: 135,778,522 (GRCm39) Y122C probably damaging Het
Sarnp A G 10: 128,682,412 (GRCm39) K5R probably damaging Het
Scg2 A T 1: 79,412,898 (GRCm39) H568Q probably damaging Het
Septin10 T C 10: 59,019,417 (GRCm39) Y150C probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Smco2 T A 6: 146,772,674 (GRCm39) V292D possibly damaging Het
Smok3c A G 5: 138,062,746 (GRCm39) M78V probably benign Het
Spag16 C A 1: 69,883,455 (GRCm39) F61L probably benign Het
Spata22 G A 11: 73,236,585 (GRCm39) R297H probably damaging Het
Spata31d1e A G 13: 59,889,571 (GRCm39) S750P probably damaging Het
Syt3 C A 7: 44,045,368 (GRCm39) P536Q probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Trim9 A C 12: 70,393,892 (GRCm39) Y17* probably null Het
Tsga10 A G 1: 37,846,163 (GRCm39) M321T probably benign Het
Ttc13 A G 8: 125,402,016 (GRCm39) L657P probably damaging Het
Ubxn1 C T 19: 8,851,588 (GRCm39) T207I probably benign Het
Vmn2r117 A T 17: 23,678,851 (GRCm39) V791D probably damaging Het
Vps54 C G 11: 21,262,260 (GRCm39) C785W possibly damaging Het
Zfp616 A G 11: 73,973,860 (GRCm39) D43G probably benign Het
Zfp952 A G 17: 33,222,928 (GRCm39) H469R probably benign Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153,341,494 (GRCm39) missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153,340,644 (GRCm39) missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153,335,312 (GRCm39) missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153,344,614 (GRCm39) splice site probably benign
IGL02938:Dhx9 APN 1 153,340,376 (GRCm39) missense probably benign 0.37
R0001:Dhx9 UTSW 1 153,338,382 (GRCm39) missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153,348,453 (GRCm39) missense probably benign 0.27
R0309:Dhx9 UTSW 1 153,341,441 (GRCm39) missense probably benign 0.00
R0517:Dhx9 UTSW 1 153,354,662 (GRCm39) missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153,348,037 (GRCm39) missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153,334,109 (GRCm39) missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153,340,684 (GRCm39) missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153,340,684 (GRCm39) missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153,359,493 (GRCm39) missense probably benign 0.44
R1456:Dhx9 UTSW 1 153,341,441 (GRCm39) missense probably benign 0.00
R1460:Dhx9 UTSW 1 153,341,426 (GRCm39) missense probably benign 0.01
R1724:Dhx9 UTSW 1 153,334,234 (GRCm39) missense probably benign 0.00
R1848:Dhx9 UTSW 1 153,341,499 (GRCm39) missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153,336,020 (GRCm39) splice site probably null
R2001:Dhx9 UTSW 1 153,331,857 (GRCm39) nonsense probably null
R3084:Dhx9 UTSW 1 153,341,445 (GRCm39) missense probably benign 0.34
R3085:Dhx9 UTSW 1 153,341,445 (GRCm39) missense probably benign 0.34
R3123:Dhx9 UTSW 1 153,341,452 (GRCm39) missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153,353,866 (GRCm39) missense probably benign 0.16
R4274:Dhx9 UTSW 1 153,344,672 (GRCm39) missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153,347,535 (GRCm39) missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153,336,049 (GRCm39) missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153,342,797 (GRCm39) frame shift probably null
R4603:Dhx9 UTSW 1 153,342,797 (GRCm39) frame shift probably null
R4889:Dhx9 UTSW 1 153,356,895 (GRCm39) missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153,348,419 (GRCm39) missense probably benign 0.02
R5411:Dhx9 UTSW 1 153,356,969 (GRCm39) missense probably benign 0.27
R5569:Dhx9 UTSW 1 153,342,838 (GRCm39) missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153,359,493 (GRCm39) missense probably benign 0.44
R5659:Dhx9 UTSW 1 153,347,481 (GRCm39) missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153,353,835 (GRCm39) missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153,348,209 (GRCm39) missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153,332,324 (GRCm39) unclassified probably benign
R6489:Dhx9 UTSW 1 153,332,389 (GRCm39) unclassified probably benign
R6717:Dhx9 UTSW 1 153,349,210 (GRCm39) splice site probably null
R7098:Dhx9 UTSW 1 153,340,768 (GRCm39) missense probably benign
R7209:Dhx9 UTSW 1 153,340,369 (GRCm39) missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153,341,423 (GRCm39) missense probably benign 0.00
R7440:Dhx9 UTSW 1 153,356,977 (GRCm39) missense probably benign
R7685:Dhx9 UTSW 1 153,334,152 (GRCm39) missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153,340,747 (GRCm39) missense probably benign 0.07
R8088:Dhx9 UTSW 1 153,338,443 (GRCm39) missense probably benign 0.26
R8371:Dhx9 UTSW 1 153,331,961 (GRCm39) missense unknown
R8397:Dhx9 UTSW 1 153,344,657 (GRCm39) missense probably damaging 1.00
R8502:Dhx9 UTSW 1 153,335,210 (GRCm39) missense probably benign 0.01
R8519:Dhx9 UTSW 1 153,348,922 (GRCm39) missense probably damaging 1.00
R8531:Dhx9 UTSW 1 153,334,182 (GRCm39) missense possibly damaging 0.95
R8842:Dhx9 UTSW 1 153,338,335 (GRCm39) missense possibly damaging 0.91
R9145:Dhx9 UTSW 1 153,336,826 (GRCm39) missense probably damaging 1.00
R9295:Dhx9 UTSW 1 153,340,673 (GRCm39) missense probably damaging 0.98
R9557:Dhx9 UTSW 1 153,333,292 (GRCm39) missense probably benign 0.10
R9661:Dhx9 UTSW 1 153,340,393 (GRCm39) missense probably damaging 1.00
X0066:Dhx9 UTSW 1 153,348,275 (GRCm39) missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153,332,321 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCAGCACAAAATCTGTTTCC -3'
(R):5'- AGGATGGTGGCTTAGCAGAC -3'

Sequencing Primer
(F):5'- TCAGCACAAAATCTGTTTCCTATCAC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On 2015-09-24