Mutagenetix > Incidental Mutation

Incidental Mutation 'R4560:Dhx9'

343025

Institutional Source

Beutler Lab

Gene Symbol

Dhx9

Ensembl Gene

ENSMUSG00000042699

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 9

Synonyms

leukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153455758-153487660 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 153467157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 533 (V533A)

Ref Sequence

ENSEMBL: ENSMUSP00000038135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000042141
AA Change: V533A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: V533A

Domain	Start	End	E-Value	Type
DSRM	4	70	2.23e-17	SMART
low complexity region	80	91	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
DSRM	184	254	3.52e-15	SMART
low complexity region	284	299	N/A	INTRINSIC
low complexity region	334	349	N/A	INTRINSIC
DEXDc	389	576	1.61e-25	SMART
low complexity region	592	608	N/A	INTRINSIC
HELICc	667	772	4.69e-18	SMART
HA2	834	922	1.33e-24	SMART
Pfam:OB_NTP_bind	961	1077	1.6e-18	PFAM
low complexity region	1173	1309	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1339	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186380
AA Change: V532A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: V532A

Domain	Start	End	E-Value	Type
DSRM	4	70	1.3e-19	SMART
low complexity region	80	91	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
DSRM	183	253	2.1e-17	SMART
low complexity region	283	298	N/A	INTRINSIC
low complexity region	333	348	N/A	INTRINSIC
DEXDc	388	575	6.6e-28	SMART
low complexity region	591	607	N/A	INTRINSIC
HELICc	666	771	1.9e-20	SMART
HA2	833	921	9.9e-29	SMART
Pfam:OB_NTP_bind	960	1076	5e-13	PFAM
low complexity region	1172	1308	N/A	INTRINSIC
low complexity region	1312	1336	N/A	INTRINSIC
low complexity region	1338	1383	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186966

SMART Domains

Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699

Domain	Start	End	E-Value	Type
DSRM	4	70	1.3e-19	SMART
low complexity region	80	91	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
DSRM	183	253	2.1e-17	SMART
low complexity region	283	298	N/A	INTRINSIC
low complexity region	333	348	N/A	INTRINSIC
Blast:DEXDc	349	451	1e-37	BLAST
PDB:3LLM\|B	349	456	2e-55	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188345
AA Change: V533A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: V533A

Domain	Start	End	E-Value	Type
DSRM	4	70	1.3e-19	SMART
low complexity region	80	91	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
DSRM	184	254	2.1e-17	SMART
low complexity region	284	299	N/A	INTRINSIC
low complexity region	334	349	N/A	INTRINSIC
DEXDc	389	576	6.6e-28	SMART
low complexity region	592	608	N/A	INTRINSIC
Pfam:Helicase_C	678	735	6.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190544

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,741,757	S750P	probably damaging	Het
Adcy4	A	C	14: 55,778,950		probably null	Het
Atp8b1	A	T	18: 64,556,879	L594*	probably null	Het
Atp8b1	C	T	18: 64,568,247	V347I	probably benign	Het
Axin1	A	G	17: 26,173,771	D342G	probably damaging	Het
Bace2	G	A	16: 97,421,980	R368Q	probably damaging	Het
Capn10	T	C	1: 92,939,362	Y105H	probably damaging	Het
Ccdc89	T	G	7: 90,427,128	L182R	probably damaging	Het
Cdk5rap2	A	G	4: 70,315,331	F537S	probably benign	Het
Cidec	A	T	6: 113,428,438	M118K	probably damaging	Het
Cog8	A	T	8: 107,052,211		probably null	Het
Ctif	A	T	18: 75,519,881	L435Q	probably damaging	Het
Drc1	T	A	5: 30,363,097	M594K	probably benign	Het
Dthd1	C	T	5: 62,827,092	T380I	probably damaging	Het
Fat2	A	G	11: 55,265,951	S3475P	possibly damaging	Het
G6pd2	G	A	5: 61,810,343	R487H	possibly damaging	Het
Hcrtr2	A	G	9: 76,254,688	V140A	probably damaging	Het
Ikbke	C	T	1: 131,272,120	C243Y	probably damaging	Het
Il21	C	A	3: 37,225,484	E128*	probably null	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Me3	G	T	7: 89,849,730	R506L	probably benign	Het
Mtf2	T	A	5: 108,086,989		probably null	Het
Nbas	A	G	12: 13,583,527	N2311S	probably benign	Het
Nomo1	G	T	7: 46,041,480	V97L	probably damaging	Het
Pcdhb11	G	A	18: 37,423,734	V706I	possibly damaging	Het
Pkhd1	G	A	1: 20,211,858	R2920C	probably damaging	Het
Prox2	T	C	12: 85,095,043	T129A	probably benign	Het
Rgs18	T	G	1: 144,755,982	I131L	probably benign	Het
Rnf19b	G	T	4: 129,071,823	C57F	probably damaging	Het
Rpl11	T	C	4: 136,051,211	Y122C	probably damaging	Het
Sarnp	A	G	10: 128,846,543	K5R	probably damaging	Het
Scg2	A	T	1: 79,435,181	H568Q	probably damaging	Het
Sept10	T	C	10: 59,183,595	Y150C	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Smco2	T	A	6: 146,871,176	V292D	possibly damaging	Het
Smok3c	A	G	5: 138,064,484	M78V	probably benign	Het
Spag16	C	A	1: 69,844,296	F61L	probably benign	Het
Spata22	G	A	11: 73,345,759	R297H	probably damaging	Het
Syt3	C	A	7: 44,395,944	P536Q	probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Trim9	A	C	12: 70,347,118	Y17*	probably null	Het
Tsga10	A	G	1: 37,807,082	M321T	probably benign	Het
Ttc13	A	G	8: 124,675,277	L657P	probably damaging	Het
Ubxn1	C	T	19: 8,874,224	T207I	probably benign	Het
Vmn2r117	A	T	17: 23,459,877	V791D	probably damaging	Het
Vps54	C	G	11: 21,312,260	C785W	possibly damaging	Het
Zfp616	A	G	11: 74,083,034	D43G	probably benign	Het
Zfp952	A	G	17: 33,003,954	H469R	probably benign	Het

Other mutations in Dhx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Dhx9	APN	1	153465748	missense	probably damaging	1.00
IGL01284:Dhx9	APN	1	153464898	missense	probably damaging	1.00
IGL01555:Dhx9	APN	1	153459566	missense	probably damaging	1.00
IGL01767:Dhx9	APN	1	153468868	splice site	probably benign
IGL02938:Dhx9	APN	1	153464630	missense	probably benign	0.37
R0001:Dhx9	UTSW	1	153462636	missense	probably damaging	1.00
R0046:Dhx9	UTSW	1	153472707	missense	probably benign	0.27
R0309:Dhx9	UTSW	1	153465695	missense	probably benign	0.00
R0517:Dhx9	UTSW	1	153478916	missense	possibly damaging	0.93
R0589:Dhx9	UTSW	1	153472291	missense	probably damaging	1.00
R1217:Dhx9	UTSW	1	153458363	missense	probably damaging	1.00
R1406:Dhx9	UTSW	1	153464938	missense	probably damaging	1.00
R1406:Dhx9	UTSW	1	153464938	missense	probably damaging	1.00
R1430:Dhx9	UTSW	1	153483747	missense	probably benign	0.44
R1456:Dhx9	UTSW	1	153465695	missense	probably benign	0.00
R1460:Dhx9	UTSW	1	153465680	missense	probably benign	0.01
R1724:Dhx9	UTSW	1	153458488	missense	probably benign	0.00
R1848:Dhx9	UTSW	1	153465753	missense	probably damaging	0.99
R1922:Dhx9	UTSW	1	153460274	splice site	probably null
R2001:Dhx9	UTSW	1	153456111	nonsense	probably null
R3084:Dhx9	UTSW	1	153465699	missense	probably benign	0.34
R3085:Dhx9	UTSW	1	153465699	missense	probably benign	0.34
R3123:Dhx9	UTSW	1	153465706	missense	possibly damaging	0.90
R3730:Dhx9	UTSW	1	153478120	missense	probably benign	0.16
R4274:Dhx9	UTSW	1	153468926	missense	probably damaging	1.00
R4353:Dhx9	UTSW	1	153471789	missense	probably damaging	1.00
R4583:Dhx9	UTSW	1	153460303	missense	probably damaging	0.98
R4598:Dhx9	UTSW	1	153467051	frame shift	probably null
R4603:Dhx9	UTSW	1	153467051	frame shift	probably null
R4889:Dhx9	UTSW	1	153481149	missense	probably damaging	1.00
R4931:Dhx9	UTSW	1	153472673	missense	probably benign	0.02
R5411:Dhx9	UTSW	1	153481223	missense	probably benign	0.27
R5569:Dhx9	UTSW	1	153467092	missense	possibly damaging	0.83
R5635:Dhx9	UTSW	1	153483747	missense	probably benign	0.44
R5659:Dhx9	UTSW	1	153471735	missense	probably damaging	1.00
R6128:Dhx9	UTSW	1	153478089	missense	probably damaging	1.00
R6215:Dhx9	UTSW	1	153472463	missense	probably damaging	1.00
R6428:Dhx9	UTSW	1	153456578	unclassified	probably benign
R6489:Dhx9	UTSW	1	153456643	unclassified	probably benign
R6717:Dhx9	UTSW	1	153473464	splice site	probably null
R7098:Dhx9	UTSW	1	153465022	missense	probably benign
R7209:Dhx9	UTSW	1	153464623	missense	possibly damaging	0.90
R7226:Dhx9	UTSW	1	153465677	missense	probably benign	0.00
R7440:Dhx9	UTSW	1	153481231	missense	probably benign
R7685:Dhx9	UTSW	1	153458406	missense	probably damaging	0.99
R7712:Dhx9	UTSW	1	153465001	missense	probably benign	0.07
R8088:Dhx9	UTSW	1	153462697	missense	probably benign	0.26
R8371:Dhx9	UTSW	1	153456215	missense	unknown
R8397:Dhx9	UTSW	1	153468911	missense	probably damaging	1.00
R8502:Dhx9	UTSW	1	153459464	missense	probably benign	0.01
R8519:Dhx9	UTSW	1	153473176	missense	probably damaging	1.00
R8531:Dhx9	UTSW	1	153458436	missense	possibly damaging	0.95
R8842:Dhx9	UTSW	1	153462589	missense	possibly damaging	0.91
R9145:Dhx9	UTSW	1	153461080	missense	probably damaging	1.00
R9295:Dhx9	UTSW	1	153464927	missense	probably damaging	0.98
R9557:Dhx9	UTSW	1	153457546	missense	probably benign	0.10
R9661:Dhx9	UTSW	1	153464647	missense	probably damaging	1.00
X0066:Dhx9	UTSW	1	153472529	missense	probably benign	0.00
Z1177:Dhx9	UTSW	1	153456575	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACTCAGCACAAAATCTGTTTCC -3'
(R):5'- AGGATGGTGGCTTAGCAGAC -3'

Sequencing Primer
(F):5'- TCAGCACAAAATCTGTTTCCTATCAC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'

Posted On

2015-09-24