Mutagenetix > Incidental Mutation

Incidental Mutation 'R4560:Dthd1'

343035

Institutional Source

Beutler Lab

Gene Symbol

Dthd1

Ensembl Gene

ENSMUSG00000090326

Gene Name

death domain containing 1

Synonyms

Gm17384

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R4560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62813823-62888308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 62827092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 380 (T380I)

Ref Sequence

ENSEMBL: ENSMUSP00000131534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170704]

AlphaFold

A0A571BG01

Predicted Effect

probably damaging
Transcript: ENSMUST00000170704
AA Change: T380I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326
AA Change: T380I

Domain	Start	End	E-Value	Type
Pfam:Death	693	778	4.2e-12	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,741,757	S750P	probably damaging	Het
Adcy4	A	C	14: 55,778,950		probably null	Het
Atp8b1	A	T	18: 64,556,879	L594*	probably null	Het
Atp8b1	C	T	18: 64,568,247	V347I	probably benign	Het
Axin1	A	G	17: 26,173,771	D342G	probably damaging	Het
Bace2	G	A	16: 97,421,980	R368Q	probably damaging	Het
Capn10	T	C	1: 92,939,362	Y105H	probably damaging	Het
Ccdc89	T	G	7: 90,427,128	L182R	probably damaging	Het
Cdk5rap2	A	G	4: 70,315,331	F537S	probably benign	Het
Cidec	A	T	6: 113,428,438	M118K	probably damaging	Het
Cog8	A	T	8: 107,052,211		probably null	Het
Ctif	A	T	18: 75,519,881	L435Q	probably damaging	Het
Dhx9	A	G	1: 153,467,157	V533A	probably damaging	Het
Drc1	T	A	5: 30,363,097	M594K	probably benign	Het
Fat2	A	G	11: 55,265,951	S3475P	possibly damaging	Het
G6pd2	G	A	5: 61,810,343	R487H	possibly damaging	Het
Hcrtr2	A	G	9: 76,254,688	V140A	probably damaging	Het
Ikbke	C	T	1: 131,272,120	C243Y	probably damaging	Het
Il21	C	A	3: 37,225,484	E128*	probably null	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Me3	G	T	7: 89,849,730	R506L	probably benign	Het
Mtf2	T	A	5: 108,086,989		probably null	Het
Nbas	A	G	12: 13,583,527	N2311S	probably benign	Het
Nomo1	G	T	7: 46,041,480	V97L	probably damaging	Het
Pcdhb11	G	A	18: 37,423,734	V706I	possibly damaging	Het
Pkhd1	G	A	1: 20,211,858	R2920C	probably damaging	Het
Prox2	T	C	12: 85,095,043	T129A	probably benign	Het
Rgs18	T	G	1: 144,755,982	I131L	probably benign	Het
Rnf19b	G	T	4: 129,071,823	C57F	probably damaging	Het
Rpl11	T	C	4: 136,051,211	Y122C	probably damaging	Het
Sarnp	A	G	10: 128,846,543	K5R	probably damaging	Het
Scg2	A	T	1: 79,435,181	H568Q	probably damaging	Het
Sept10	T	C	10: 59,183,595	Y150C	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Smco2	T	A	6: 146,871,176	V292D	possibly damaging	Het
Smok3c	A	G	5: 138,064,484	M78V	probably benign	Het
Spag16	C	A	1: 69,844,296	F61L	probably benign	Het
Spata22	G	A	11: 73,345,759	R297H	probably damaging	Het
Syt3	C	A	7: 44,395,944	P536Q	probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Trim9	A	C	12: 70,347,118	Y17*	probably null	Het
Tsga10	A	G	1: 37,807,082	M321T	probably benign	Het
Ttc13	A	G	8: 124,675,277	L657P	probably damaging	Het
Ubxn1	C	T	19: 8,874,224	T207I	probably benign	Het
Vmn2r117	A	T	17: 23,459,877	V791D	probably damaging	Het
Vps54	C	G	11: 21,312,260	C785W	possibly damaging	Het
Zfp616	A	G	11: 74,083,034	D43G	probably benign	Het
Zfp952	A	G	17: 33,003,954	H469R	probably benign	Het

Other mutations in Dthd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Boatman	UTSW	5	62818715	missense	probably benign	0.28
Coin	UTSW	5	62842916	missense	probably damaging	0.98
FR4340:Dthd1	UTSW	5	62843026	small insertion	probably benign
FR4342:Dthd1	UTSW	5	62843026	small insertion	probably benign
FR4589:Dthd1	UTSW	5	62843026	frame shift	probably null
FR4976:Dthd1	UTSW	5	62843024	small insertion	probably benign
R0096:Dthd1	UTSW	5	62843040	missense	possibly damaging	0.75
R0096:Dthd1	UTSW	5	62843040	missense	possibly damaging	0.75
R0395:Dthd1	UTSW	5	62814333	missense	possibly damaging	0.71
R0734:Dthd1	UTSW	5	62839410	splice site	probably benign
R0899:Dthd1	UTSW	5	62842928	missense	probably benign	0.01
R0970:Dthd1	UTSW	5	62887981	missense	probably damaging	1.00
R1104:Dthd1	UTSW	5	62821959	missense	probably damaging	1.00
R1518:Dthd1	UTSW	5	62822040	missense	probably damaging	1.00
R1831:Dthd1	UTSW	5	62827229	missense	probably benign	0.02
R2110:Dthd1	UTSW	5	62821908	missense	probably damaging	1.00
R2110:Dthd1	UTSW	5	62842879	missense	probably damaging	0.99
R2112:Dthd1	UTSW	5	62821908	missense	probably damaging	1.00
R2112:Dthd1	UTSW	5	62842879	missense	probably damaging	0.99
R2248:Dthd1	UTSW	5	62849900	missense	probably damaging	0.99
R2311:Dthd1	UTSW	5	62839237	splice site	probably benign
R2937:Dthd1	UTSW	5	62842957	missense	probably benign	0.02
R2938:Dthd1	UTSW	5	62842957	missense	probably benign	0.02
R3835:Dthd1	UTSW	5	62849785	missense	probably damaging	1.00
R3855:Dthd1	UTSW	5	62827129	missense	probably benign	0.21
R3855:Dthd1	UTSW	5	62888023	missense	probably benign	0.00
R4049:Dthd1	UTSW	5	62827165	nonsense	probably null
R4321:Dthd1	UTSW	5	62818690	missense	probably damaging	0.99
R4353:Dthd1	UTSW	5	62842867	missense	probably benign	0.04
R4613:Dthd1	UTSW	5	62827068	missense	probably damaging	1.00
R4689:Dthd1	UTSW	5	62842912	missense	probably damaging	0.99
R4715:Dthd1	UTSW	5	62888187	missense	probably benign
R4718:Dthd1	UTSW	5	62818793	missense	probably damaging	1.00
R4967:Dthd1	UTSW	5	62888206	missense	probably benign	0.01
R5068:Dthd1	UTSW	5	62818716	missense	probably benign
R5089:Dthd1	UTSW	5	62849905	missense	probably benign
R5355:Dthd1	UTSW	5	62839387	missense	probably damaging	1.00
R5470:Dthd1	UTSW	5	62818766	missense	probably damaging	1.00
R6284:Dthd1	UTSW	5	62814041	missense	possibly damaging	0.71
R6293:Dthd1	UTSW	5	62842850	missense	probably damaging	0.99
R6484:Dthd1	UTSW	5	62814332	missense	probably benign	0.34
R6516:Dthd1	UTSW	5	62839264	missense	probably benign	0.16
R6741:Dthd1	UTSW	5	62842946	missense	probably damaging	1.00
R6810:Dthd1	UTSW	5	62814329	missense	probably benign	0.01
R7565:Dthd1	UTSW	5	62843092	missense	probably damaging	1.00
R7595:Dthd1	UTSW	5	62818715	missense	probably benign	0.28
R7947:Dthd1	UTSW	5	62814310	missense	possibly damaging	0.90
R8131:Dthd1	UTSW	5	62842916	missense	probably damaging	0.98
R8356:Dthd1	UTSW	5	62849738	missense	probably damaging	1.00
R8829:Dthd1	UTSW	5	62814265	missense	probably benign	0.01
R8832:Dthd1	UTSW	5	62814265	missense	probably benign	0.01
R8945:Dthd1	UTSW	5	62849753	missense	probably benign	0.02
R9046:Dthd1	UTSW	5	62827260	missense	possibly damaging	0.87
R9180:Dthd1	UTSW	5	62888067	missense	probably benign	0.02
R9390:Dthd1	UTSW	5	62818561	missense	possibly damaging	0.83
R9462:Dthd1	UTSW	5	62882283	missense	probably benign	0.01
R9463:Dthd1	UTSW	5	62882283	missense	probably benign	0.01
R9464:Dthd1	UTSW	5	62882283	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCAGAGTTAGACAACTTTTCCC -3'
(R):5'- CACCTGTTGAAATAGGAGGGTG -3'

Sequencing Primer
(F):5'- TGCCATTGTTATGTGAGAAGAAC -3'
(R):5'- GTTTGCAGGCTCCTGTGCAC -3'

Posted On

2015-09-24