Incidental Mutation 'R4560:Trim9'
ID343057
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R4560 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 70347118 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 17 (Y17*)
Ref Sequence ENSEMBL: ENSMUSP00000152887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably null
Transcript: ENSMUST00000110520
AA Change: Y17*
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: Y17*

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110522
AA Change: Y17*
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: Y17*

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167755
AA Change: Y17*
SMART Domains Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: Y17*

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221041
AA Change: Y17*
Predicted Effect probably null
Transcript: ENSMUST00000221294
Predicted Effect probably null
Transcript: ENSMUST00000221370
AA Change: Y17*
Predicted Effect probably null
Transcript: ENSMUST00000222316
AA Change: Y17*
Predicted Effect probably null
Transcript: ENSMUST00000223160
AA Change: Y17*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223521
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,757 S750P probably damaging Het
Adcy4 A C 14: 55,778,950 probably null Het
Atp8b1 A T 18: 64,556,879 L594* probably null Het
Atp8b1 C T 18: 64,568,247 V347I probably benign Het
Axin1 A G 17: 26,173,771 D342G probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Cog8 A T 8: 107,052,211 probably null Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Scg2 A T 1: 79,435,181 H568Q probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Zfp952 A G 17: 33,003,954 H469R probably benign Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0622:Trim9 UTSW 12 70346604 missense probably damaging 1.00
R0941:Trim9 UTSW 12 70248263 missense probably damaging 0.97
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1613:Trim9 UTSW 12 70248395 missense probably damaging 1.00
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1722:Trim9 UTSW 12 70248374 missense probably benign 0.33
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3738:Trim9 UTSW 12 70251195 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R5471:Trim9 UTSW 12 70346792 missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
R7549:Trim9 UTSW 12 70346941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGCTGTACAGGCTCATCTTG -3'
(R):5'- AAGAAAGCAGCTCTCACGGC -3'

Sequencing Primer
(F):5'- GTCCAGGTCCAGATAATCATAGTCAG -3'
(R):5'- TCACAGAGAGAGCGCATCCTG -3'
Posted On2015-09-24