Mutagenetix > Incidental Mutation

Incidental Mutation 'R4560:Vmn2r117'

343063

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R4560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23459877 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 791 (V791D)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: V791D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: V791D

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,741,757	S750P	probably damaging	Het
Adcy4	A	C	14: 55,778,950		probably null	Het
Atp8b1	A	T	18: 64,556,879	L594*	probably null	Het
Atp8b1	C	T	18: 64,568,247	V347I	probably benign	Het
Axin1	A	G	17: 26,173,771	D342G	probably damaging	Het
Bace2	G	A	16: 97,421,980	R368Q	probably damaging	Het
Capn10	T	C	1: 92,939,362	Y105H	probably damaging	Het
Ccdc89	T	G	7: 90,427,128	L182R	probably damaging	Het
Cdk5rap2	A	G	4: 70,315,331	F537S	probably benign	Het
Cidec	A	T	6: 113,428,438	M118K	probably damaging	Het
Cog8	A	T	8: 107,052,211		probably null	Het
Ctif	A	T	18: 75,519,881	L435Q	probably damaging	Het
Dhx9	A	G	1: 153,467,157	V533A	probably damaging	Het
Drc1	T	A	5: 30,363,097	M594K	probably benign	Het
Dthd1	C	T	5: 62,827,092	T380I	probably damaging	Het
Fat2	A	G	11: 55,265,951	S3475P	possibly damaging	Het
G6pd2	G	A	5: 61,810,343	R487H	possibly damaging	Het
Hcrtr2	A	G	9: 76,254,688	V140A	probably damaging	Het
Ikbke	C	T	1: 131,272,120	C243Y	probably damaging	Het
Il21	C	A	3: 37,225,484	E128*	probably null	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Me3	G	T	7: 89,849,730	R506L	probably benign	Het
Mtf2	T	A	5: 108,086,989		probably null	Het
Nbas	A	G	12: 13,583,527	N2311S	probably benign	Het
Nomo1	G	T	7: 46,041,480	V97L	probably damaging	Het
Pcdhb11	G	A	18: 37,423,734	V706I	possibly damaging	Het
Pkhd1	G	A	1: 20,211,858	R2920C	probably damaging	Het
Prox2	T	C	12: 85,095,043	T129A	probably benign	Het
Rgs18	T	G	1: 144,755,982	I131L	probably benign	Het
Rnf19b	G	T	4: 129,071,823	C57F	probably damaging	Het
Rpl11	T	C	4: 136,051,211	Y122C	probably damaging	Het
Sarnp	A	G	10: 128,846,543	K5R	probably damaging	Het
Scg2	A	T	1: 79,435,181	H568Q	probably damaging	Het
Sept10	T	C	10: 59,183,595	Y150C	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Smco2	T	A	6: 146,871,176	V292D	possibly damaging	Het
Smok3c	A	G	5: 138,064,484	M78V	probably benign	Het
Spag16	C	A	1: 69,844,296	F61L	probably benign	Het
Spata22	G	A	11: 73,345,759	R297H	probably damaging	Het
Syt3	C	A	7: 44,395,944	P536Q	probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Trim9	A	C	12: 70,347,118	Y17*	probably null	Het
Tsga10	A	G	1: 37,807,082	M321T	probably benign	Het
Ttc13	A	G	8: 124,675,277	L657P	probably damaging	Het
Ubxn1	C	T	19: 8,874,224	T207I	probably benign	Het
Vps54	C	G	11: 21,312,260	C785W	possibly damaging	Het
Zfp616	A	G	11: 74,083,034	D43G	probably benign	Het
Zfp952	A	G	17: 33,003,954	H469R	probably benign	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGAAGATGATTTCACCCTGATCATTTC -3'
(R):5'- AGTCTGGCTGAGAGCTTCTC -3'

Sequencing Primer
(F):5'- GATTTCACCCTGATCATTTCAAGAG -3'
(R):5'- TGCACATTCTGAGCATGGAC -3'

Posted On

2015-09-24