Incidental Mutation 'R4560:Axin1'
ID343064
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4560 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26173771 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect probably damaging
Transcript: ENSMUST00000074370
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: D342G

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: D342G

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: D342G

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,757 S750P probably damaging Het
Adcy4 A C 14: 55,778,950 probably null Het
Atp8b1 A T 18: 64,556,879 L594* probably null Het
Atp8b1 C T 18: 64,568,247 V347I probably benign Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Cog8 A T 8: 107,052,211 probably null Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Scg2 A T 1: 79,435,181 H568Q probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Trim9 A C 12: 70,347,118 Y17* probably null Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Zfp952 A G 17: 33,003,954 H469R probably benign Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAATTGCTCTGCTGCCACTC -3'
(R):5'- CACTTACAGGGTAGTCTGTCATC -3'

Sequencing Primer
(F):5'- TGCTGCCACTCATGCAC -3'
(R):5'- CTCACAAGCATCTGTAGTGGGATC -3'
Posted On2015-09-24