Incidental Mutation 'R4560:Zfp952'
ID343065
Institutional Source Beutler Lab
Gene Symbol Zfp952
Ensembl Gene ENSMUSG00000053390
Gene Namezinc finger protein 952
SynonymsC920016K16Rik
Accession Numbers

Genbank: NM_001045559; MGI: 2441928

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4560 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32993129-33005457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33003954 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 469 (H469R)
Ref Sequence ENSEMBL: ENSMUSP00000084949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087666] [ENSMUST00000157017]
Predicted Effect probably benign
Transcript: ENSMUST00000087666
AA Change: H469R

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084949
Gene: ENSMUSG00000053390
AA Change: H469R

DomainStartEndE-ValueType
KRAB 10 73 4.6e-14 SMART
ZnF_C2H2 251 273 3.44e-4 SMART
ZnF_C2H2 279 301 1.28e-3 SMART
ZnF_C2H2 307 329 1.36e-2 SMART
ZnF_C2H2 335 357 2.75e-3 SMART
ZnF_C2H2 363 385 9.44e-2 SMART
ZnF_C2H2 391 413 1.47e-3 SMART
ZnF_C2H2 419 441 2.91e-2 SMART
ZnF_C2H2 447 469 2.57e-3 SMART
ZnF_C2H2 475 497 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141815
Predicted Effect probably benign
Transcript: ENSMUST00000157017
SMART Domains Protein: ENSMUSP00000123066
Gene: ENSMUSG00000053390

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,757 S750P probably damaging Het
Adcy4 A C 14: 55,778,950 probably null Het
Atp8b1 A T 18: 64,556,879 L594* probably null Het
Atp8b1 C T 18: 64,568,247 V347I probably benign Het
Axin1 A G 17: 26,173,771 D342G probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Cog8 A T 8: 107,052,211 probably null Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Scg2 A T 1: 79,435,181 H568Q probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Trim9 A C 12: 70,347,118 Y17* probably null Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Other mutations in Zfp952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Zfp952 APN 17 33002817 missense probably benign 0.00
IGL02560:Zfp952 APN 17 33002819 nonsense probably null
IGL03056:Zfp952 APN 17 33002766 missense probably damaging 0.98
IGL03151:Zfp952 APN 17 33003008 missense probably benign 0.01
0152:Zfp952 UTSW 17 33003221 splice site probably null
R0508:Zfp952 UTSW 17 33003005 missense possibly damaging 0.90
R1936:Zfp952 UTSW 17 33003669 missense possibly damaging 0.71
R3882:Zfp952 UTSW 17 33001975 nonsense probably null
R4649:Zfp952 UTSW 17 33002925 missense probably damaging 0.99
R7103:Zfp952 UTSW 17 33003632 missense possibly damaging 0.94
R7207:Zfp952 UTSW 17 33003515 missense possibly damaging 0.93
R7209:Zfp952 UTSW 17 33003470 missense possibly damaging 0.71
R7508:Zfp952 UTSW 17 33003782 missense probably benign 0.06
R7699:Zfp952 UTSW 17 33002009 missense possibly damaging 0.53
R8424:Zfp952 UTSW 17 33003217 missense probably benign 0.18
R8445:Zfp952 UTSW 17 33003578 missense possibly damaging 0.78
Z1177:Zfp952 UTSW 17 33003104 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAAGCCTTCACCCATTCCA -3'
(R):5'- TGCAAATGACAGCACATATGTACA -3'

Sequencing Primer
(F):5'- GAAACCCTACGTTTGTAAGCACTGTG -3'
(R):5'- TGAGGTTCCAACTATGGCTACCAAG -3'
Posted On2015-09-24