Mutagenetix > Incidental Mutation

Incidental Mutation 'R4561:Erbb4'

343074

Institutional Source

Beutler Lab

Gene Symbol

Erbb4

Ensembl Gene

ENSMUSG00000062209

Gene Name

erb-b2 receptor tyrosine kinase 4

Synonyms

Her4, ErbB4

MMRRC Submission

041786-MU

Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68032186-69108059 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 68343921 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 306 (R306*)

Ref Sequence

ENSEMBL: ENSMUSP00000115373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]

AlphaFold

Q61527

Predicted Effect

probably null
Transcript: ENSMUST00000119142
AA Change: R306*

SMART Domains

Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: R306*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	5e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	1e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121473
AA Change: R306*

SMART Domains

Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: R306*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.6e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.5e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000153432
AA Change: R306*

SMART Domains

Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: R306*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.7e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.7e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	649	2.98e0	SMART
PDB:2R4B\|B	680	732	1e-25	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	T	C	10: 70,002,018	S1601P	probably damaging	Het
Arnt	A	G	3: 95,452,613	N56D	probably damaging	Het
Atad5	A	G	11: 80,095,889	T601A	probably benign	Het
Calr4	A	G	4: 109,246,182	N163S	probably damaging	Het
Cenpc1	C	A	5: 86,047,632	A93S	probably damaging	Het
Cep135	C	T	5: 76,638,193	H1048Y	possibly damaging	Het
Ctnna2	A	G	6: 77,636,713		probably null	Het
Ddx60	T	C	8: 61,942,461	L144P	probably damaging	Het
Dera	A	T	6: 137,780,738	T96S	possibly damaging	Het
Dock9	T	A	14: 121,559,007	M1853L	probably benign	Het
Glyat	G	T	19: 12,651,280	L146F	possibly damaging	Het
Grk4	C	A	5: 34,694,813	Q134K	probably benign	Het
Hkdc1	T	C	10: 62,409,839	Q181R	probably benign	Het
Huwe1	A	T	X: 151,863,959	I682F	probably damaging	Het
Ipo4	C	T	14: 55,630,089		probably benign	Het
Ivl	CCTGCTGCTGCT	CCTGCTGCTGCTGCT	3: 92,571,955		probably benign	Het
Kcnd2	A	G	6: 21,216,396	Q33R	probably benign	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Klhl30	A	T	1: 91,361,031	H504L	probably damaging	Het
Map4	A	G	9: 110,052,371	Y101C	possibly damaging	Het
Mfn2	C	A	4: 147,877,035	R707L	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myof	T	C	19: 37,922,990	N1511D	probably benign	Het
Neb	A	T	2: 52,286,155	Y1431N	probably damaging	Het
Nlrc5	A	G	8: 94,477,146	T625A	probably damaging	Het
Olfr996	G	T	2: 85,579,620	C127F	probably damaging	Het
Pax2	A	G	19: 44,835,963	Y374C	unknown	Het
Pde8a	T	A	7: 81,308,820	Y315*	probably null	Het
Pkhd1	A	T	1: 20,534,719	L1124Q	possibly damaging	Het
Ppp1r3a	A	G	6: 14,754,682	F189L	probably damaging	Het
Prex2	G	A	1: 11,184,545		probably null	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc22a22	T	A	15: 57,263,385	Q77L	probably damaging	Het
Slc24a2	A	T	4: 87,227,397	V140D	probably damaging	Het
Slc35g2	C	A	9: 100,553,234	R128L	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Spag7	T	C	11: 70,664,990	I80M	probably damaging	Het
Srgap3	A	G	6: 112,781,054	M164T	probably damaging	Het
Sspo	A	T	6: 48,475,534		probably null	Het
Tcte2	T	C	17: 13,722,602		probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Tmtc4	T	C	14: 122,963,298	T194A	probably benign	Het
Ttc21b	T	C	2: 66,186,218	Y1269C	probably damaging	Het
Zfp236	A	T	18: 82,620,406	I1363N	probably damaging	Het
Zfp760	T	A	17: 21,723,667	S608T	probably benign	Het
Zfp947	G	T	17: 22,146,143	Y183*	probably null	Het

Other mutations in Erbb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Erbb4	APN	1	68071630	nonsense	probably null
IGL01020:Erbb4	APN	1	68298449	splice site	probably benign
IGL01349:Erbb4	APN	1	68346593	missense	probably benign	0.00
IGL01386:Erbb4	APN	1	68343931	missense	probably damaging	1.00
IGL01516:Erbb4	APN	1	68328245	nonsense	probably null
IGL01536:Erbb4	APN	1	68290282	missense	probably benign	0.00
IGL01721:Erbb4	APN	1	68254563	missense	possibly damaging	0.46
IGL01832:Erbb4	APN	1	68254566	missense	possibly damaging	0.84
IGL02002:Erbb4	APN	1	68080726	missense	probably damaging	1.00
IGL02040:Erbb4	APN	1	68042535	missense	probably damaging	1.00
IGL02371:Erbb4	APN	1	68290294	missense	probably benign	0.00
IGL02399:Erbb4	APN	1	68042437	splice site	probably benign
IGL02553:Erbb4	APN	1	68305864	missense	probably benign	0.17
IGL03118:Erbb4	APN	1	68042719	missense	probably benign	0.11
IGL03329:Erbb4	APN	1	68328122	missense	probably benign	0.30
IGL03405:Erbb4	APN	1	68330238	missense	probably benign	0.02
earthworm	UTSW	1	68250580	missense	possibly damaging	0.67
excrescence	UTSW	1	68330246	missense	probably damaging	1.00
Mole	UTSW	1	68560576	missense	probably damaging	1.00
P0018:Erbb4	UTSW	1	68071676	missense	probably benign	0.05
PIT4480001:Erbb4	UTSW	1	68075543	missense	probably damaging	1.00
R0193:Erbb4	UTSW	1	68043960	intron	probably benign
R0329:Erbb4	UTSW	1	68298280	splice site	probably benign
R0335:Erbb4	UTSW	1	68259259	missense	probably benign
R0362:Erbb4	UTSW	1	68330270	missense	probably damaging	0.99
R0579:Erbb4	UTSW	1	68042462	missense	probably benign	0.17
R0730:Erbb4	UTSW	1	68259290	missense	probably damaging	0.98
R1029:Erbb4	UTSW	1	68309614	missense	probably damaging	0.96
R1444:Erbb4	UTSW	1	68254600	missense	probably damaging	1.00
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1503:Erbb4	UTSW	1	68346546	missense	probably benign	0.00
R1523:Erbb4	UTSW	1	68396252	missense	possibly damaging	0.95
R1528:Erbb4	UTSW	1	68078582	nonsense	probably null
R1604:Erbb4	UTSW	1	68346569	missense	possibly damaging	0.88
R1611:Erbb4	UTSW	1	68040388	missense	probably damaging	1.00
R1642:Erbb4	UTSW	1	68331234	missense	probably damaging	1.00
R1905:Erbb4	UTSW	1	68075410	splice site	probably benign
R1929:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2046:Erbb4	UTSW	1	68298323	missense	probably benign	0.02
R2139:Erbb4	UTSW	1	68346629	missense	probably damaging	0.96
R2271:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2298:Erbb4	UTSW	1	68042531	missense	probably damaging	1.00
R2356:Erbb4	UTSW	1	68078596	missense	probably benign	0.00
R3821:Erbb4	UTSW	1	68305913	missense	probably damaging	0.97
R4007:Erbb4	UTSW	1	68740401	missense	probably damaging	1.00
R4012:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R4077:Erbb4	UTSW	1	68040337	missense	probably benign	0.07
R4196:Erbb4	UTSW	1	68343855	missense	possibly damaging	0.90
R4536:Erbb4	UTSW	1	68346622	missense	probably damaging	1.00
R4642:Erbb4	UTSW	1	68250632	missense	probably damaging	1.00
R4737:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4739:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4780:Erbb4	UTSW	1	68298314	missense	probably damaging	1.00
R4801:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4802:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4811:Erbb4	UTSW	1	68254544	missense	probably damaging	1.00
R4832:Erbb4	UTSW	1	68330238	missense	probably benign	0.02
R5068:Erbb4	UTSW	1	68043902	splice site	probably null
R5546:Erbb4	UTSW	1	68298293	missense	probably damaging	0.99
R5755:Erbb4	UTSW	1	68560519	missense	possibly damaging	0.96
R6189:Erbb4	UTSW	1	68043916	missense	probably benign
R6257:Erbb4	UTSW	1	68396273	missense	probably damaging	1.00
R6276:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R6521:Erbb4	UTSW	1	68042530	missense	probably damaging	1.00
R6602:Erbb4	UTSW	1	68370503	missense	probably damaging	0.99
R6808:Erbb4	UTSW	1	68040303	missense	probably benign	0.00
R7087:Erbb4	UTSW	1	68740491	missense	probably null	1.00
R7215:Erbb4	UTSW	1	68339460	missense	probably benign
R7356:Erbb4	UTSW	1	68339355	critical splice donor site	probably null
R7509:Erbb4	UTSW	1	68250580	missense	possibly damaging	0.67
R7593:Erbb4	UTSW	1	68254599	missense	probably damaging	0.99
R7743:Erbb4	UTSW	1	68328119	missense	probably benign	0.00
R7784:Erbb4	UTSW	1	68075499	missense	probably damaging	1.00
R7815:Erbb4	UTSW	1	68042726	missense	probably damaging	1.00
R7923:Erbb4	UTSW	1	68259209	missense	probably damaging	1.00
R8071:Erbb4	UTSW	1	68396311	missense	probably damaging	1.00
R8288:Erbb4	UTSW	1	68298350	missense	probably damaging	1.00
R8356:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8456:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8464:Erbb4	UTSW	1	68309626	missense	probably benign
R8783:Erbb4	UTSW	1	68040172	missense	possibly damaging	0.95
R8830:Erbb4	UTSW	1	68075468	missense	probably damaging	1.00
R8881:Erbb4	UTSW	1	68343838	critical splice donor site	probably null
R9053:Erbb4	UTSW	1	68250620	missense	possibly damaging	0.63
R9142:Erbb4	UTSW	1	68349393	missense	probably damaging	1.00
R9237:Erbb4	UTSW	1	68042442	missense	possibly damaging	0.72
R9350:Erbb4	UTSW	1	68290479	missense	probably benign	0.00
R9374:Erbb4	UTSW	1	68740483	nonsense	probably null
R9434:Erbb4	UTSW	1	68042614	missense	possibly damaging	0.84
R9499:Erbb4	UTSW	1	68740483	nonsense	probably null
R9551:Erbb4	UTSW	1	68740483	nonsense	probably null
R9753:Erbb4	UTSW	1	68198903	missense	probably benign	0.00
X0019:Erbb4	UTSW	1	68073145	missense	probably benign	0.00
Z1176:Erbb4	UTSW	1	68298402	frame shift	probably null
Z1176:Erbb4	UTSW	1	68328259	nonsense	probably null
Z1177:Erbb4	UTSW	1	68259183	frame shift	probably null
Z1177:Erbb4	UTSW	1	68290476	missense	probably damaging	1.00
Z1177:Erbb4	UTSW	1	68309643	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCTAATCCCACTGGCCTATTAAAAG -3'
(R):5'- GAGTGCGTGCATTGAAGATG -3'

Sequencing Primer
(F):5'- CTAGACCAGACTGTTCTAGAGTTCG -3'
(R):5'- CATTGAAGATGTTGTTTCAGGTTCC -3'

Posted On

2015-09-24