Incidental Mutation 'R4561:Or5g27'
ID 343079
Institutional Source Beutler Lab
Gene Symbol Or5g27
Ensembl Gene ENSMUSG00000111179
Gene Name olfactory receptor family 5 subfamily G member 27
Synonyms MOR175-4, GA_x6K02T2Q125-47058060-47059004, Olfr996
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 85409559-85410626 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 85409964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 127 (C127F)
Ref Sequence ENSEMBL: ENSMUSP00000076330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077075]
AlphaFold Q7TRA0
Predicted Effect probably damaging
Transcript: ENSMUST00000077075
AA Change: C127F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076330
Gene: ENSMUSG00000111179
AA Change: C127F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-52 PFAM
Pfam:7tm_1 41 290 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Or5g27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Or5g27 APN 2 85,409,875 (GRCm39) nonsense probably null
IGL01972:Or5g27 APN 2 85,410,117 (GRCm39) missense probably damaging 1.00
IGL02102:Or5g27 APN 2 85,410,017 (GRCm39) missense probably damaging 0.98
IGL03159:Or5g27 APN 2 85,410,284 (GRCm39) missense probably damaging 0.99
R0539:Or5g27 UTSW 2 85,410,119 (GRCm39) missense probably damaging 0.99
R4275:Or5g27 UTSW 2 85,410,207 (GRCm39) missense probably benign 0.07
R4953:Or5g27 UTSW 2 85,410,069 (GRCm39) nonsense probably null
R5794:Or5g27 UTSW 2 85,409,685 (GRCm39) missense probably benign 0.03
R6061:Or5g27 UTSW 2 85,409,886 (GRCm39) missense possibly damaging 0.48
R6695:Or5g27 UTSW 2 85,409,793 (GRCm39) missense probably damaging 1.00
R6981:Or5g27 UTSW 2 85,409,825 (GRCm39) missense probably benign 0.06
R7030:Or5g27 UTSW 2 85,409,746 (GRCm39) missense possibly damaging 0.56
R7399:Or5g27 UTSW 2 85,409,640 (GRCm39) missense probably benign 0.00
R8914:Or5g27 UTSW 2 85,410,056 (GRCm39) missense possibly damaging 0.72
R9594:Or5g27 UTSW 2 85,409,882 (GRCm39) nonsense probably null
R9686:Or5g27 UTSW 2 85,410,340 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTGCACACACCTATGTAC -3'
(R):5'- TGTCAGAACATGCTAGAGACAGC -3'

Sequencing Primer
(F):5'- CAGCCAACTGTCTTTTGTAGATG -3'
(R):5'- CAGCAATGGGGAAATGTCAC -3'
Posted On 2015-09-24