Incidental Mutation 'R0346:Trim36'
ID34308
Institutional Source Beutler Lab
Gene Symbol Trim36
Ensembl Gene ENSMUSG00000033949
Gene Nametripartite motif-containing 36
SynonymsHaprin, D18Wsu100e
MMRRC Submission 038553-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46165302-46212607 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 46199709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037011] [ENSMUST00000167364]
Predicted Effect probably benign
Transcript: ENSMUST00000037011
SMART Domains Protein: ENSMUSP00000037978
Gene: ENSMUSG00000033949

DomainStartEndE-ValueType
RING 33 118 1.25e-5 SMART
BBOX 207 249 1.82e-7 SMART
Blast:BBC 256 381 5e-11 BLAST
FN3 418 498 1.32e-1 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000167364
SMART Domains Protein: ENSMUSP00000129771
Gene: ENSMUSG00000033949

DomainStartEndE-ValueType
RING 21 106 1.25e-5 SMART
BBOX 195 237 1.82e-7 SMART
Blast:BBC 244 369 4e-11 BLAST
FN3 406 486 1.32e-1 SMART
Pfam:SPRY 560 704 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195587
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Trim36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Trim36 APN 18 46188388 splice site probably benign
IGL02728:Trim36 APN 18 46172602 missense probably benign 0.00
IGL03166:Trim36 APN 18 46212321 missense probably benign
IGL03209:Trim36 APN 18 46167508 missense probably benign
R0426:Trim36 UTSW 18 46172525 missense probably damaging 0.97
R0463:Trim36 UTSW 18 46178456 missense possibly damaging 0.89
R0590:Trim36 UTSW 18 46172576 missense probably benign 0.01
R0751:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1037:Trim36 UTSW 18 46196318 splice site probably benign
R1184:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1522:Trim36 UTSW 18 46186183 nonsense probably null
R1571:Trim36 UTSW 18 46172495 missense probably benign 0.01
R1687:Trim36 UTSW 18 46188657 missense possibly damaging 0.93
R2057:Trim36 UTSW 18 46196162 missense probably benign 0.02
R2103:Trim36 UTSW 18 46196082 missense probably benign
R2127:Trim36 UTSW 18 46212337 missense probably benign 0.27
R3853:Trim36 UTSW 18 46172372 splice site probably benign
R4209:Trim36 UTSW 18 46196124 missense probably benign 0.44
R4787:Trim36 UTSW 18 46172532 missense probably benign 0.10
R4810:Trim36 UTSW 18 46172469 missense probably benign 0.07
R4953:Trim36 UTSW 18 46196178 missense possibly damaging 0.90
R5107:Trim36 UTSW 18 46172638 missense probably benign
R5320:Trim36 UTSW 18 46167498 missense probably damaging 1.00
R5683:Trim36 UTSW 18 46169292 missense probably damaging 1.00
R5823:Trim36 UTSW 18 46169340 missense probably damaging 1.00
R6619:Trim36 UTSW 18 46188408 missense probably damaging 0.96
R7349:Trim36 UTSW 18 46169428 missense probably benign 0.29
R7814:Trim36 UTSW 18 46167624 missense possibly damaging 0.64
R7853:Trim36 UTSW 18 46172491 missense probably benign 0.14
R7936:Trim36 UTSW 18 46172491 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCTTGTGGTTCCGCATCTGAAGAG -3'
(R):5'- GCTATGCCATTAGACGCTGTAGTCC -3'

Sequencing Primer
(F):5'- CGCATCTGAAGAGCGTGG -3'
(R):5'- CCTGGTTGACAAAGAAGTTACC -3'
Posted On2013-05-09