Incidental Mutation 'R4561:Slc24a2'
ID 343082
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Name solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms 6330417K15Rik
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 86901361-87148714 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87145634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 140 (V140D)
Ref Sequence ENSEMBL: ENSMUSP00000043937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
AlphaFold Q14BI1
Predicted Effect probably damaging
Transcript: ENSMUST00000044990
AA Change: V140D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: V140D

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107155
AA Change: V140D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: V140D

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107157
AA Change: V140D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: V140D

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107158
AA Change: V140D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: V140D

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155361
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87,146,033 (GRCm39) missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87,145,383 (GRCm39) missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87,145,143 (GRCm39) missense probably benign 0.00
G1patch:Slc24a2 UTSW 4 87,145,119 (GRCm39) critical splice donor site probably null
PIT4403001:Slc24a2 UTSW 4 86,950,523 (GRCm39) missense probably benign 0.45
R0024:Slc24a2 UTSW 4 86,946,477 (GRCm39) unclassified probably benign
R0024:Slc24a2 UTSW 4 86,946,477 (GRCm39) unclassified probably benign
R0372:Slc24a2 UTSW 4 87,145,529 (GRCm39) missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 86,950,512 (GRCm39) missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86,909,648 (GRCm39) missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87,094,526 (GRCm39) missense probably benign 0.01
R1955:Slc24a2 UTSW 4 86,991,481 (GRCm39) missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86,914,882 (GRCm39) missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 86,929,883 (GRCm39) missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86,909,592 (GRCm39) missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86,909,591 (GRCm39) missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86,909,591 (GRCm39) missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 86,929,961 (GRCm39) missense probably benign 0.34
R3806:Slc24a2 UTSW 4 87,146,021 (GRCm39) missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87,094,422 (GRCm39) missense probably benign
R4052:Slc24a2 UTSW 4 87,145,442 (GRCm39) missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87,145,442 (GRCm39) missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87,146,099 (GRCm39) utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86,909,715 (GRCm39) missense possibly damaging 0.91
R4808:Slc24a2 UTSW 4 86,950,475 (GRCm39) missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86,909,745 (GRCm39) missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87,145,145 (GRCm39) missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87,145,584 (GRCm39) missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 86,929,943 (GRCm39) missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86,914,871 (GRCm39) missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86,909,625 (GRCm39) missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 86,929,825 (GRCm39) splice site probably null
R6046:Slc24a2 UTSW 4 86,914,882 (GRCm39) missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87,145,119 (GRCm39) critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87,094,529 (GRCm39) missense probably benign
R7087:Slc24a2 UTSW 4 86,909,456 (GRCm39) splice site probably null
R7804:Slc24a2 UTSW 4 86,909,774 (GRCm39) missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87,094,552 (GRCm39) missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86,909,750 (GRCm39) missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87,145,337 (GRCm39) missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 86,946,517 (GRCm39) missense possibly damaging 0.51
R9656:Slc24a2 UTSW 4 86,968,144 (GRCm39) missense probably damaging 1.00
X0003:Slc24a2 UTSW 4 86,909,684 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCGACATTGCTGTGAGC -3'
(R):5'- TGATATGAGTGGCCCCAGAGTAG -3'

Sequencing Primer
(F):5'- GCTGTGAGCAATGAAGACCCC -3'
(R):5'- TAGCACAGGGTCACCGTCAAAG -3'
Posted On 2015-09-24