Incidental Mutation 'R4561:Grk4'
ID 343085
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene Name G protein-coupled receptor kinase 4
Synonyms Gprk2l, A830025H08Rik
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 34817723-34912649 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34852157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 134 (Q134K)
Ref Sequence ENSEMBL: ENSMUSP00000074223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112] [ENSMUST00000074651]
AlphaFold O70291
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: Q134K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: Q134K

DomainStartEndE-ValueType
RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074651
AA Change: Q134K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074223
Gene: ENSMUSG00000052783
AA Change: Q134K

DomainStartEndE-ValueType
RGS 51 163 1.39e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201216
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34,873,634 (GRCm39) missense probably damaging 0.99
IGL00574:Grk4 APN 5 34,852,162 (GRCm39) missense probably benign 0.00
IGL02127:Grk4 APN 5 34,867,530 (GRCm39) missense probably benign 0.00
IGL02191:Grk4 APN 5 34,912,533 (GRCm39) missense probably benign 0.27
IGL02227:Grk4 APN 5 34,852,126 (GRCm39) missense probably benign 0.06
IGL03152:Grk4 APN 5 34,902,701 (GRCm39) missense probably damaging 1.00
IGL03214:Grk4 APN 5 34,909,553 (GRCm39) missense probably benign
F5426:Grk4 UTSW 5 34,902,503 (GRCm39) splice site probably benign
R0110:Grk4 UTSW 5 34,873,557 (GRCm39) missense probably damaging 0.97
R0469:Grk4 UTSW 5 34,873,557 (GRCm39) missense probably damaging 0.97
R0671:Grk4 UTSW 5 34,905,611 (GRCm39) missense probably benign 0.04
R1466:Grk4 UTSW 5 34,852,094 (GRCm39) missense probably benign 0.02
R1466:Grk4 UTSW 5 34,852,094 (GRCm39) missense probably benign 0.02
R1584:Grk4 UTSW 5 34,852,094 (GRCm39) missense probably benign 0.02
R1605:Grk4 UTSW 5 34,831,901 (GRCm39) missense probably damaging 0.98
R1607:Grk4 UTSW 5 34,888,882 (GRCm39) missense probably benign 0.01
R1903:Grk4 UTSW 5 34,833,531 (GRCm39) splice site probably null
R2352:Grk4 UTSW 5 34,826,520 (GRCm39) missense probably benign 0.04
R4580:Grk4 UTSW 5 34,818,325 (GRCm39) missense probably damaging 1.00
R4807:Grk4 UTSW 5 34,909,552 (GRCm39) missense probably benign
R5412:Grk4 UTSW 5 34,902,612 (GRCm39) missense probably benign 0.00
R5905:Grk4 UTSW 5 34,869,074 (GRCm39) missense probably damaging 1.00
R6360:Grk4 UTSW 5 34,831,881 (GRCm39) missense probably damaging 1.00
R6604:Grk4 UTSW 5 34,877,208 (GRCm39) missense probably damaging 1.00
R6865:Grk4 UTSW 5 34,888,894 (GRCm39) missense probably damaging 1.00
R7265:Grk4 UTSW 5 34,873,608 (GRCm39) missense probably damaging 0.96
R7394:Grk4 UTSW 5 34,908,962 (GRCm39) missense probably benign
R7718:Grk4 UTSW 5 34,852,160 (GRCm39) missense probably benign
R7821:Grk4 UTSW 5 34,867,553 (GRCm39) missense probably damaging 1.00
R8074:Grk4 UTSW 5 34,833,482 (GRCm39) missense probably benign 0.30
R8218:Grk4 UTSW 5 34,826,540 (GRCm39) missense probably benign 0.01
R8499:Grk4 UTSW 5 34,902,690 (GRCm39) missense possibly damaging 0.90
R9026:Grk4 UTSW 5 34,877,084 (GRCm39) missense probably damaging 1.00
R9068:Grk4 UTSW 5 34,905,653 (GRCm39) missense
X0064:Grk4 UTSW 5 34,877,228 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGTACTGGGTGATACTTTGACT -3'
(R):5'- TCTTTTGTCTTGGCGGTTACCA -3'

Sequencing Primer
(F):5'- AGAGTAGGCATTAGGTTCTTTG -3'
(R):5'- TACCATCCTAGAGCCTTAGAAGTAGG -3'
Posted On 2015-09-24