Mutagenetix > Incidental Mutation

Incidental Mutation 'R4561:Ppp1r3a'

343088

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r3a

Ensembl Gene

ENSMUSG00000042717

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 3A

Synonyms

RGL, GM

MMRRC Submission

041786-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14713977-14755274 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14754682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 189 (F189L)

Ref Sequence

ENSEMBL: ENSMUSP00000049054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045096]

AlphaFold

Q99MR9

Predicted Effect

probably damaging
Transcript: ENSMUST00000045096
AA Change: F189L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: F189L

Domain	Start	End	E-Value	Type
low complexity region	37	51	N/A	INTRINSIC
Pfam:CBM_21	124	231	2.3e-32	PFAM
low complexity region	370	381	N/A	INTRINSIC
low complexity region	636	646	N/A	INTRINSIC
low complexity region	952	961	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	T	C	10: 70,002,018	S1601P	probably damaging	Het
Arnt	A	G	3: 95,452,613	N56D	probably damaging	Het
Atad5	A	G	11: 80,095,889	T601A	probably benign	Het
Calr4	A	G	4: 109,246,182	N163S	probably damaging	Het
Cenpc1	C	A	5: 86,047,632	A93S	probably damaging	Het
Cep135	C	T	5: 76,638,193	H1048Y	possibly damaging	Het
Ctnna2	A	G	6: 77,636,713		probably null	Het
Ddx60	T	C	8: 61,942,461	L144P	probably damaging	Het
Dera	A	T	6: 137,780,738	T96S	possibly damaging	Het
Dock9	T	A	14: 121,559,007	M1853L	probably benign	Het
Erbb4	G	A	1: 68,343,921	R306*	probably null	Het
Glyat	G	T	19: 12,651,280	L146F	possibly damaging	Het
Grk4	C	A	5: 34,694,813	Q134K	probably benign	Het
Hkdc1	T	C	10: 62,409,839	Q181R	probably benign	Het
Huwe1	A	T	X: 151,863,959	I682F	probably damaging	Het
Ipo4	C	T	14: 55,630,089		probably benign	Het
Ivl	CCTGCTGCTGCT	CCTGCTGCTGCTGCT	3: 92,571,955		probably benign	Het
Kcnd2	A	G	6: 21,216,396	Q33R	probably benign	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Klhl30	A	T	1: 91,361,031	H504L	probably damaging	Het
Map4	A	G	9: 110,052,371	Y101C	possibly damaging	Het
Mfn2	C	A	4: 147,877,035	R707L	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myof	T	C	19: 37,922,990	N1511D	probably benign	Het
Neb	A	T	2: 52,286,155	Y1431N	probably damaging	Het
Nlrc5	A	G	8: 94,477,146	T625A	probably damaging	Het
Olfr996	G	T	2: 85,579,620	C127F	probably damaging	Het
Pax2	A	G	19: 44,835,963	Y374C	unknown	Het
Pde8a	T	A	7: 81,308,820	Y315*	probably null	Het
Pkhd1	A	T	1: 20,534,719	L1124Q	possibly damaging	Het
Prex2	G	A	1: 11,184,545		probably null	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc22a22	T	A	15: 57,263,385	Q77L	probably damaging	Het
Slc24a2	A	T	4: 87,227,397	V140D	probably damaging	Het
Slc35g2	C	A	9: 100,553,234	R128L	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Spag7	T	C	11: 70,664,990	I80M	probably damaging	Het
Srgap3	A	G	6: 112,781,054	M164T	probably damaging	Het
Sspo	A	T	6: 48,475,534		probably null	Het
Tcte2	T	C	17: 13,722,602		probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Tmtc4	T	C	14: 122,963,298	T194A	probably benign	Het
Ttc21b	T	C	2: 66,186,218	Y1269C	probably damaging	Het
Zfp236	A	T	18: 82,620,406	I1363N	probably damaging	Het
Zfp760	T	A	17: 21,723,667	S608T	probably benign	Het
Zfp947	G	T	17: 22,146,143	Y183*	probably null	Het

Other mutations in Ppp1r3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ppp1r3a	APN	6	14755084	missense	probably damaging	1.00
IGL00670:Ppp1r3a	APN	6	14719060	missense	probably benign	0.22
IGL00703:Ppp1r3a	APN	6	14718408	missense	probably benign	0.02
IGL00726:Ppp1r3a	APN	6	14717852	missense	probably benign	0.42
IGL00742:Ppp1r3a	APN	6	14718609	missense	probably benign	0.36
IGL01477:Ppp1r3a	APN	6	14718346	missense	probably damaging	0.99
IGL01632:Ppp1r3a	APN	6	14754811	missense	probably damaging	1.00
IGL02162:Ppp1r3a	APN	6	14717715	missense	probably damaging	1.00
IGL02374:Ppp1r3a	APN	6	14718600	missense	probably damaging	1.00
IGL02539:Ppp1r3a	APN	6	14718459	missense	probably benign	0.01
IGL02563:Ppp1r3a	APN	6	14719762	missense	probably benign	0.20
IGL02929:Ppp1r3a	APN	6	14719811	missense	probably benign	0.00
IGL03110:Ppp1r3a	APN	6	14722065	splice site	probably benign
IGL03290:Ppp1r3a	APN	6	14754772	missense	probably damaging	1.00
IGL03326:Ppp1r3a	APN	6	14719766	missense	probably damaging	0.96
P0041:Ppp1r3a	UTSW	6	14719697	missense	probably benign	0.00
PIT4445001:Ppp1r3a	UTSW	6	14717777	missense	probably damaging	1.00
R0015:Ppp1r3a	UTSW	6	14717661	missense	possibly damaging	0.58
R0077:Ppp1r3a	UTSW	6	14754517	missense	possibly damaging	0.64
R0368:Ppp1r3a	UTSW	6	14718960	missense	probably benign	0.26
R0391:Ppp1r3a	UTSW	6	14719697	missense	probably benign	0.43
R1793:Ppp1r3a	UTSW	6	14754718	missense	probably damaging	1.00
R1797:Ppp1r3a	UTSW	6	14717982	missense	probably benign	0.02
R1855:Ppp1r3a	UTSW	6	14754994	missense	probably damaging	1.00
R1864:Ppp1r3a	UTSW	6	14718405	missense	probably damaging	1.00
R1865:Ppp1r3a	UTSW	6	14718405	missense	probably damaging	1.00
R2046:Ppp1r3a	UTSW	6	14722104	missense	probably benign	0.12
R2122:Ppp1r3a	UTSW	6	14721875	missense	possibly damaging	0.95
R2437:Ppp1r3a	UTSW	6	14718323	missense	probably benign	0.03
R2518:Ppp1r3a	UTSW	6	14719378	missense	possibly damaging	0.95
R2887:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R2888:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R2889:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R3419:Ppp1r3a	UTSW	6	14719414	missense	probably benign	0.01
R3886:Ppp1r3a	UTSW	6	14719912	missense	possibly damaging	0.87
R3937:Ppp1r3a	UTSW	6	14719074	missense	probably damaging	0.99
R3938:Ppp1r3a	UTSW	6	14719074	missense	probably damaging	0.99
R4246:Ppp1r3a	UTSW	6	14719781	missense	probably damaging	1.00
R4701:Ppp1r3a	UTSW	6	14718993	missense	probably benign	0.00
R4853:Ppp1r3a	UTSW	6	14719047	missense	probably benign	0.03
R5076:Ppp1r3a	UTSW	6	14754681	missense	probably damaging	1.00
R5085:Ppp1r3a	UTSW	6	14719604	missense	probably damaging	1.00
R5501:Ppp1r3a	UTSW	6	14719418	missense	probably benign	0.02
R5725:Ppp1r3a	UTSW	6	14719349	missense	probably benign	0.04
R5729:Ppp1r3a	UTSW	6	14719763	missense	probably benign	0.06
R5741:Ppp1r3a	UTSW	6	14719883	missense	probably damaging	0.97
R5841:Ppp1r3a	UTSW	6	14718984	missense	probably benign	0.26
R5914:Ppp1r3a	UTSW	6	14718989	missense	probably benign	0.09
R6091:Ppp1r3a	UTSW	6	14719340	missense	probably benign	0.02
R6154:Ppp1r3a	UTSW	6	14754604	missense	possibly damaging	0.88
R6218:Ppp1r3a	UTSW	6	14718431	missense	probably damaging	0.99
R6813:Ppp1r3a	UTSW	6	14719571	missense	probably benign	0.13
R6826:Ppp1r3a	UTSW	6	14718981	nonsense	probably null
R6869:Ppp1r3a	UTSW	6	14754826	missense	probably benign	0.39
R7109:Ppp1r3a	UTSW	6	14719236	missense	probably benign	0.00
R7188:Ppp1r3a	UTSW	6	14719191	missense	probably benign	0.00
R7262:Ppp1r3a	UTSW	6	14719070	missense	probably benign	0.04
R7341:Ppp1r3a	UTSW	6	14718750	missense	probably damaging	0.97
R7770:Ppp1r3a	UTSW	6	14754978	missense	probably benign	0.06
R7856:Ppp1r3a	UTSW	6	14718026	missense	probably benign	0.01
R8309:Ppp1r3a	UTSW	6	14719701	missense	probably benign	0.02
R8422:Ppp1r3a	UTSW	6	14718435	nonsense	probably null
R8868:Ppp1r3a	UTSW	6	14755015	missense	probably damaging	1.00
R9039:Ppp1r3a	UTSW	6	14754526	missense	probably damaging	1.00
R9149:Ppp1r3a	UTSW	6	14722099	missense	probably benign	0.32
R9302:Ppp1r3a	UTSW	6	14721892	missense	probably benign	0.00
R9399:Ppp1r3a	UTSW	6	14755011	missense	probably damaging	0.99
R9565:Ppp1r3a	UTSW	6	14719467	missense	probably benign	0.02
R9730:Ppp1r3a	UTSW	6	14721924	missense	probably benign	0.25
R9767:Ppp1r3a	UTSW	6	14718102	missense	probably benign	0.03
R9782:Ppp1r3a	UTSW	6	14718767	missense	probably damaging	1.00
Z1177:Ppp1r3a	UTSW	6	14755151	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CCGTGATTTTACCTTTAAGCAGC -3'
(R):5'- AAGTCCAGAAAGCCGTGCTG -3'

Sequencing Primer
(F):5'- AGGTGCTTCTTCCAATGGC -3'
(R):5'- TGGAGTCCGCTGAACACCTTC -3'

Posted On

2015-09-24