Incidental Mutation 'R4561:Ppp1r3a'
ID 343088
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14754681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 189 (F189L)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably damaging
Transcript: ENSMUST00000045096
AA Change: F189L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: F189L

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCGTGATTTTACCTTTAAGCAGC -3'
(R):5'- AAGTCCAGAAAGCCGTGCTG -3'

Sequencing Primer
(F):5'- AGGTGCTTCTTCCAATGGC -3'
(R):5'- TGGAGTCCGCTGAACACCTTC -3'
Posted On 2015-09-24