Incidental Mutation 'R4561:Kcnd2'
ID 343089
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 21215502-21729804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21216395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 33 (Q33R)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably benign
Transcript: ENSMUST00000081542
AA Change: Q33R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: Q33R

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21,714,153 (GRCm39) missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21,217,216 (GRCm39) missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21,727,339 (GRCm39) makesense probably null
IGL01534:Kcnd2 APN 6 21,726,144 (GRCm39) missense probably benign
IGL02623:Kcnd2 APN 6 21,726,194 (GRCm39) missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21,216,924 (GRCm39) nonsense probably null
IGL02874:Kcnd2 APN 6 21,216,922 (GRCm39) missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21,217,148 (GRCm39) missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21,216,554 (GRCm39) missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21,216,508 (GRCm39) nonsense probably null
IGL03154:Kcnd2 APN 6 21,216,707 (GRCm39) missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21,216,515 (GRCm39) missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21,714,208 (GRCm39) missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21,216,682 (GRCm39) missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21,216,441 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,727,328 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,726,238 (GRCm39) splice site probably benign
R0884:Kcnd2 UTSW 6 21,216,540 (GRCm39) missense probably benign
R1434:Kcnd2 UTSW 6 21,216,356 (GRCm39) missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21,216,431 (GRCm39) missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21,217,262 (GRCm39) nonsense probably null
R3939:Kcnd2 UTSW 6 21,217,095 (GRCm39) missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21,216,896 (GRCm39) missense probably damaging 0.99
R4707:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5523:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5545:Kcnd2 UTSW 6 21,217,018 (GRCm39) missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21,217,084 (GRCm39) missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21,216,587 (GRCm39) missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21,216,707 (GRCm39) missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21,216,177 (GRCm39) start gained probably benign
R7183:Kcnd2 UTSW 6 21,216,436 (GRCm39) missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21,216,777 (GRCm39) missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21,216,497 (GRCm39) missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21,217,073 (GRCm39) missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21,726,197 (GRCm39) nonsense probably null
R8465:Kcnd2 UTSW 6 21,216,695 (GRCm39) missense probably damaging 1.00
R9329:Kcnd2 UTSW 6 21,725,981 (GRCm39) missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21,727,180 (GRCm39) missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21,216,367 (GRCm39) missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21,217,322 (GRCm39) missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21,216,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTGAGGTGAAGAAGTG -3'
(R):5'- ATAGTGAAGCTTCCCCGTGC -3'

Sequencing Primer
(F):5'- CTTCCAGACAACATGGCA -3'
(R):5'- TCCCCGTGCGGTAGAAGTTG -3'
Posted On 2015-09-24