Mutagenetix > Incidental Mutation

Incidental Mutation 'R4561:Kcnd2'

343089

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

041786-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R4561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21216396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 33 (Q33R)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably benign
Transcript: ENSMUST00000081542
AA Change: Q33R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: Q33R

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	T	C	10: 70,002,018	S1601P	probably damaging	Het
Arnt	A	G	3: 95,452,613	N56D	probably damaging	Het
Atad5	A	G	11: 80,095,889	T601A	probably benign	Het
Calr4	A	G	4: 109,246,182	N163S	probably damaging	Het
Cenpc1	C	A	5: 86,047,632	A93S	probably damaging	Het
Cep135	C	T	5: 76,638,193	H1048Y	possibly damaging	Het
Ctnna2	A	G	6: 77,636,713		probably null	Het
Ddx60	T	C	8: 61,942,461	L144P	probably damaging	Het
Dera	A	T	6: 137,780,738	T96S	possibly damaging	Het
Dock9	T	A	14: 121,559,007	M1853L	probably benign	Het
Erbb4	G	A	1: 68,343,921	R306*	probably null	Het
Glyat	G	T	19: 12,651,280	L146F	possibly damaging	Het
Grk4	C	A	5: 34,694,813	Q134K	probably benign	Het
Hkdc1	T	C	10: 62,409,839	Q181R	probably benign	Het
Huwe1	A	T	X: 151,863,959	I682F	probably damaging	Het
Ipo4	C	T	14: 55,630,089		probably benign	Het
Ivl	CCTGCTGCTGCT	CCTGCTGCTGCTGCT	3: 92,571,955		probably benign	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Klhl30	A	T	1: 91,361,031	H504L	probably damaging	Het
Map4	A	G	9: 110,052,371	Y101C	possibly damaging	Het
Mfn2	C	A	4: 147,877,035	R707L	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myof	T	C	19: 37,922,990	N1511D	probably benign	Het
Neb	A	T	2: 52,286,155	Y1431N	probably damaging	Het
Nlrc5	A	G	8: 94,477,146	T625A	probably damaging	Het
Olfr996	G	T	2: 85,579,620	C127F	probably damaging	Het
Pax2	A	G	19: 44,835,963	Y374C	unknown	Het
Pde8a	T	A	7: 81,308,820	Y315*	probably null	Het
Pkhd1	A	T	1: 20,534,719	L1124Q	possibly damaging	Het
Ppp1r3a	A	G	6: 14,754,682	F189L	probably damaging	Het
Prex2	G	A	1: 11,184,545		probably null	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc22a22	T	A	15: 57,263,385	Q77L	probably damaging	Het
Slc24a2	A	T	4: 87,227,397	V140D	probably damaging	Het
Slc35g2	C	A	9: 100,553,234	R128L	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Spag7	T	C	11: 70,664,990	I80M	probably damaging	Het
Srgap3	A	G	6: 112,781,054	M164T	probably damaging	Het
Sspo	A	T	6: 48,475,534		probably null	Het
Tcte2	T	C	17: 13,722,602		probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Tmtc4	T	C	14: 122,963,298	T194A	probably benign	Het
Ttc21b	T	C	2: 66,186,218	Y1269C	probably damaging	Het
Zfp236	A	T	18: 82,620,406	I1363N	probably damaging	Het
Zfp760	T	A	17: 21,723,667	S608T	probably benign	Het
Zfp947	G	T	17: 22,146,143	Y183*	probably null	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCTGAGGTGAAGAAGTG -3'
(R):5'- ATAGTGAAGCTTCCCCGTGC -3'

Sequencing Primer
(F):5'- CTTCCAGACAACATGGCA -3'
(R):5'- TCCCCGTGCGGTAGAAGTTG -3'

Posted On

2015-09-24