Mutagenetix > Incidental Mutation

Incidental Mutation 'R4561:Nlrc5'

343101

Institutional Source

Beutler Lab

Gene Symbol

Nlrc5

Ensembl Gene

ENSMUSG00000074151

Gene Name

NLR family, CARD domain containing 5

Synonyms

AI451557

MMRRC Submission

041786-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94434356-94527272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94477146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 625 (T625A)

Ref Sequence

ENSEMBL: ENSMUSP00000148677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]

AlphaFold

C3VPR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000053085
AA Change: T625A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: T625A

Domain	Start	End	E-Value	Type
low complexity region	136	151	N/A	INTRINSIC
Pfam:NACHT	223	386	1.8e-32	PFAM
LRR	716	743	6.89e1	SMART
LRR	744	771	9.86e1	SMART
LRR	772	796	1.22e2	SMART
LRR	844	870	2.16e2	SMART
LRR	871	898	1.76e-1	SMART
LRR	1006	1033	1.9e0	SMART
LRR	1034	1061	4.51e1	SMART
low complexity region	1141	1169	N/A	INTRINSIC
LRR	1240	1267	2.67e1	SMART
LRR	1273	1295	1.22e1	SMART
low complexity region	1341	1351	N/A	INTRINSIC
LRR	1519	1546	5.48e1	SMART
LRR	1547	1574	3.36e1	SMART
LRR	1575	1602	1.69e1	SMART
LRR	1603	1630	8.99e-1	SMART
LRR	1631	1654	5.26e0	SMART
LRR	1659	1686	2.81e0	SMART
LRR	1687	1714	1.6e-4	SMART
LRR	1715	1742	1.06e0	SMART
LRR	1743	1768	8e0	SMART
LRR	1793	1820	2.06e1	SMART
LRR	1821	1848	5.42e-2	SMART
LRR	1849	1876	3.54e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182409
AA Change: T625A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000183132

Predicted Effect

probably damaging
Transcript: ENSMUST00000211816
AA Change: T625A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	T	C	10: 70,002,018	S1601P	probably damaging	Het
Arnt	A	G	3: 95,452,613	N56D	probably damaging	Het
Atad5	A	G	11: 80,095,889	T601A	probably benign	Het
Calr4	A	G	4: 109,246,182	N163S	probably damaging	Het
Cenpc1	C	A	5: 86,047,632	A93S	probably damaging	Het
Cep135	C	T	5: 76,638,193	H1048Y	possibly damaging	Het
Ctnna2	A	G	6: 77,636,713		probably null	Het
Ddx60	T	C	8: 61,942,461	L144P	probably damaging	Het
Dera	A	T	6: 137,780,738	T96S	possibly damaging	Het
Dock9	T	A	14: 121,559,007	M1853L	probably benign	Het
Erbb4	G	A	1: 68,343,921	R306*	probably null	Het
Glyat	G	T	19: 12,651,280	L146F	possibly damaging	Het
Grk4	C	A	5: 34,694,813	Q134K	probably benign	Het
Hkdc1	T	C	10: 62,409,839	Q181R	probably benign	Het
Huwe1	A	T	X: 151,863,959	I682F	probably damaging	Het
Ipo4	C	T	14: 55,630,089		probably benign	Het
Ivl	CCTGCTGCTGCT	CCTGCTGCTGCTGCT	3: 92,571,955		probably benign	Het
Kcnd2	A	G	6: 21,216,396	Q33R	probably benign	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Klhl30	A	T	1: 91,361,031	H504L	probably damaging	Het
Map4	A	G	9: 110,052,371	Y101C	possibly damaging	Het
Mfn2	C	A	4: 147,877,035	R707L	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myof	T	C	19: 37,922,990	N1511D	probably benign	Het
Neb	A	T	2: 52,286,155	Y1431N	probably damaging	Het
Olfr996	G	T	2: 85,579,620	C127F	probably damaging	Het
Pax2	A	G	19: 44,835,963	Y374C	unknown	Het
Pde8a	T	A	7: 81,308,820	Y315*	probably null	Het
Pkhd1	A	T	1: 20,534,719	L1124Q	possibly damaging	Het
Ppp1r3a	A	G	6: 14,754,682	F189L	probably damaging	Het
Prex2	G	A	1: 11,184,545		probably null	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc22a22	T	A	15: 57,263,385	Q77L	probably damaging	Het
Slc24a2	A	T	4: 87,227,397	V140D	probably damaging	Het
Slc35g2	C	A	9: 100,553,234	R128L	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Spag7	T	C	11: 70,664,990	I80M	probably damaging	Het
Srgap3	A	G	6: 112,781,054	M164T	probably damaging	Het
Sspo	A	T	6: 48,475,534		probably null	Het
Tcte2	T	C	17: 13,722,602		probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Tmtc4	T	C	14: 122,963,298	T194A	probably benign	Het
Ttc21b	T	C	2: 66,186,218	Y1269C	probably damaging	Het
Zfp236	A	T	18: 82,620,406	I1363N	probably damaging	Het
Zfp760	T	A	17: 21,723,667	S608T	probably benign	Het
Zfp947	G	T	17: 22,146,143	Y183*	probably null	Het

Other mutations in Nlrc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Nlrc5	APN	8	94502211	splice site	probably benign
IGL00232:Nlrc5	APN	8	94484623	critical splice donor site	probably null
IGL00324:Nlrc5	APN	8	94521479	missense	probably damaging	1.00
IGL02715:Nlrc5	APN	8	94474668	missense	probably damaging	1.00
IGL02992:Nlrc5	APN	8	94506573	missense	possibly damaging	0.69
IGL03095:Nlrc5	APN	8	94521908	splice site	probably benign
IGL03389:Nlrc5	APN	8	94521474	missense	probably damaging	1.00
IGL03406:Nlrc5	APN	8	94476855	missense	probably benign	0.01
cassis	UTSW	8	94476393	nonsense	probably null
cowberry	UTSW	8	94491525	missense	possibly damaging	0.83
lingon	UTSW	8	94481860	missense	probably damaging	1.00
R0037:Nlrc5	UTSW	8	94489535	missense	probably benign	0.00
R0048:Nlrc5	UTSW	8	94474656	missense	possibly damaging	0.81
R0092:Nlrc5	UTSW	8	94489594	splice site	probably benign
R0506:Nlrc5	UTSW	8	94493125	splice site	probably benign
R0548:Nlrc5	UTSW	8	94521783	missense	probably null	0.09
R2014:Nlrc5	UTSW	8	94525510	splice site	probably benign
R3051:Nlrc5	UTSW	8	94476715	missense	probably benign	0.01
R3776:Nlrc5	UTSW	8	94472839	missense	possibly damaging	0.48
R3837:Nlrc5	UTSW	8	94511301	splice site	probably benign
R4012:Nlrc5	UTSW	8	94475992	missense	possibly damaging	0.92
R4367:Nlrc5	UTSW	8	94476564	missense	probably damaging	1.00
R4400:Nlrc5	UTSW	8	94494353	missense	probably benign	0.08
R4469:Nlrc5	UTSW	8	94520839	missense	probably damaging	1.00
R4584:Nlrc5	UTSW	8	94477275	missense	probably damaging	0.96
R4758:Nlrc5	UTSW	8	94512328	missense	possibly damaging	0.70
R4834:Nlrc5	UTSW	8	94505485	missense	probably benign	0.00
R4896:Nlrc5	UTSW	8	94521216	unclassified	probably benign
R5004:Nlrc5	UTSW	8	94521216	unclassified	probably benign
R5018:Nlrc5	UTSW	8	94525452	missense	probably damaging	1.00
R5115:Nlrc5	UTSW	8	94476819	missense	possibly damaging	0.67
R5116:Nlrc5	UTSW	8	94481860	missense	probably damaging	1.00
R5126:Nlrc5	UTSW	8	94474671	missense	possibly damaging	0.95
R5148:Nlrc5	UTSW	8	94476693	missense	probably damaging	1.00
R5224:Nlrc5	UTSW	8	94494316	missense	probably benign	0.26
R5527:Nlrc5	UTSW	8	94490416	missense	probably damaging	1.00
R5640:Nlrc5	UTSW	8	94475793	missense	probably benign	0.02
R5705:Nlrc5	UTSW	8	94475757	missense	probably benign	0.00
R5778:Nlrc5	UTSW	8	94479526	missense	possibly damaging	0.66
R5830:Nlrc5	UTSW	8	94472914	missense	probably damaging	1.00
R5850:Nlrc5	UTSW	8	94521047	missense	probably benign	0.00
R5978:Nlrc5	UTSW	8	94488593	missense	probably damaging	0.98
R6335:Nlrc5	UTSW	8	94502274	missense	probably benign	0.01
R6372:Nlrc5	UTSW	8	94479750	missense	probably damaging	0.98
R6486:Nlrc5	UTSW	8	94521299	splice site	probably null
R6765:Nlrc5	UTSW	8	94490368	missense	probably benign	0.20
R6861:Nlrc5	UTSW	8	94521229	unclassified	probably benign
R6869:Nlrc5	UTSW	8	94521955	missense	probably benign	0.00
R7134:Nlrc5	UTSW	8	94479722	missense	probably damaging	0.99
R7204:Nlrc5	UTSW	8	94491525	missense	possibly damaging	0.83
R7231:Nlrc5	UTSW	8	94521805	critical splice donor site	probably null
R7309:Nlrc5	UTSW	8	94474042	missense	probably benign	0.01
R7368:Nlrc5	UTSW	8	94476393	nonsense	probably null
R7497:Nlrc5	UTSW	8	94521970	missense	probably damaging	1.00
R7606:Nlrc5	UTSW	8	94477117	missense	possibly damaging	0.67
R7611:Nlrc5	UTSW	8	94512648	critical splice donor site	probably null
R7685:Nlrc5	UTSW	8	94521400	splice site	probably null
R7810:Nlrc5	UTSW	8	94505144	missense	possibly damaging	0.85
R7829:Nlrc5	UTSW	8	94521769	missense	probably damaging	1.00
R7910:Nlrc5	UTSW	8	94493092	missense	probably benign	0.00
R7921:Nlrc5	UTSW	8	94487664	missense	probably damaging	1.00
R8131:Nlrc5	UTSW	8	94481792	missense	probably damaging	1.00
R8237:Nlrc5	UTSW	8	94526125	missense	unknown
R8493:Nlrc5	UTSW	8	94523220	missense	probably damaging	1.00
R8888:Nlrc5	UTSW	8	94525490	missense	probably benign	0.04
R8964:Nlrc5	UTSW	8	94505488	missense	possibly damaging	0.54
R9053:Nlrc5	UTSW	8	94490385	missense	probably benign	0.00
R9058:Nlrc5	UTSW	8	94512310	missense	possibly damaging	0.86
R9161:Nlrc5	UTSW	8	94486646	missense	probably damaging	0.97
R9278:Nlrc5	UTSW	8	94511280	missense	probably benign	0.00
R9285:Nlrc5	UTSW	8	94472976	missense	probably damaging	1.00
R9405:Nlrc5	UTSW	8	94473024	missense	probably damaging	0.98
R9591:Nlrc5	UTSW	8	94522681	missense	probably damaging	1.00
R9620:Nlrc5	UTSW	8	94476406	missense	probably benign	0.44
RF021:Nlrc5	UTSW	8	94476888	missense	probably benign	0.16
Z1088:Nlrc5	UTSW	8	94504464	missense	possibly damaging	0.48
Z1177:Nlrc5	UTSW	8	94506580	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGGTAGACTGGGCCTCTC -3'
(R):5'- GACTCACCTGAGATTCTCCAC -3'

Sequencing Primer
(F):5'- TAGACTGGGCCTCTCGGATCATC -3'
(R):5'- GAGATTCTCCACCTGCCCAC -3'

Posted On

2015-09-24