Incidental Mutation 'R4561:Hkdc1'
ID 343105
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Name hexokinase domain containing 1
Synonyms
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 62218916-62258270 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62245618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 181 (Q181R)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
AlphaFold Q91W97
Predicted Effect probably benign
Transcript: ENSMUST00000020277
AA Change: Q181R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: Q181R

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159454
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62,229,568 (GRCm39) missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62,231,040 (GRCm39) splice site probably benign
IGL01415:Hkdc1 APN 10 62,229,638 (GRCm39) missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62,236,165 (GRCm39) missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62,235,970 (GRCm39) critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62,253,608 (GRCm39) missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62,221,484 (GRCm39) missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62,247,486 (GRCm39) missense probably null 0.04
R0549:Hkdc1 UTSW 10 62,236,019 (GRCm39) missense probably benign
R0667:Hkdc1 UTSW 10 62,247,644 (GRCm39) splice site probably benign
R0751:Hkdc1 UTSW 10 62,234,452 (GRCm39) missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62,227,162 (GRCm39) missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62,253,677 (GRCm39) missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62,253,677 (GRCm39) missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62,235,991 (GRCm39) missense probably benign
R4480:Hkdc1 UTSW 10 62,227,151 (GRCm39) missense probably benign
R4576:Hkdc1 UTSW 10 62,221,622 (GRCm39) missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62,236,242 (GRCm39) missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62,236,133 (GRCm39) missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62,247,304 (GRCm39) missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62,231,053 (GRCm39) intron probably benign
R5138:Hkdc1 UTSW 10 62,234,470 (GRCm39) missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62,253,712 (GRCm39) missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62,244,445 (GRCm39) missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62,229,589 (GRCm39) missense probably benign
R6418:Hkdc1 UTSW 10 62,219,583 (GRCm39) missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62,229,481 (GRCm39) missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62,231,220 (GRCm39) missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62,239,385 (GRCm39) missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62,244,477 (GRCm39) missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62,237,711 (GRCm39) missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62,229,622 (GRCm39) missense probably damaging 1.00
R7395:Hkdc1 UTSW 10 62,221,478 (GRCm39) missense probably damaging 1.00
R8498:Hkdc1 UTSW 10 62,221,662 (GRCm39) missense probably benign
R8777:Hkdc1 UTSW 10 62,234,612 (GRCm39) missense possibly damaging 0.94
R8777-TAIL:Hkdc1 UTSW 10 62,234,612 (GRCm39) missense possibly damaging 0.94
R8894:Hkdc1 UTSW 10 62,244,400 (GRCm39) missense probably damaging 1.00
R8989:Hkdc1 UTSW 10 62,229,544 (GRCm39) missense probably damaging 1.00
R9331:Hkdc1 UTSW 10 62,236,114 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGCTCCTCTTCACTACAAAG -3'
(R):5'- GCACTGAACCTGCCTAGCATAC -3'

Sequencing Primer
(F):5'- ACCAAGGTGAACCCCTT -3'
(R):5'- ATTAGAAACAAAATCAAACCCCAAAG -3'
Posted On 2015-09-24