Mutagenetix > Incidental Mutation

Incidental Mutation 'R4561:Pax2'

343118

Institutional Source

Beutler Lab

Gene Symbol

Pax2

Ensembl Gene

ENSMUSG00000004231

Gene Name

paired box 2

Synonyms

Pax-2, Opdc

MMRRC Submission

041786-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44756045-44837871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44835963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 374 (Y374C)

Ref Sequence

ENSEMBL: ENSMUSP00000134661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000174490]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000004340
AA Change: Y396C

SMART Domains

Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: Y396C

Domain	Start	End	E-Value	Type
PAX	15	139	4e-96	SMART
low complexity region	165	177	N/A	INTRINSIC
SCOP:d1ftt__	246	280	1e-4	SMART
Pfam:Pax2_C	300	415	1.1e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174082

Predicted Effect

unknown
Transcript: ENSMUST00000174490
AA Change: Y374C

SMART Domains

Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: Y374C

Domain	Start	End	E-Value	Type
PAX	16	140	2.3e-96	SMART
low complexity region	166	178	N/A	INTRINSIC
SCOP:d1ftt__	224	258	8e-5	SMART
Pfam:Pax2_C	278	393	6.3e-57	PFAM

Meta Mutation Damage Score

0.1387

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	T	C	10: 70,002,018	S1601P	probably damaging	Het
Arnt	A	G	3: 95,452,613	N56D	probably damaging	Het
Atad5	A	G	11: 80,095,889	T601A	probably benign	Het
Calr4	A	G	4: 109,246,182	N163S	probably damaging	Het
Cenpc1	C	A	5: 86,047,632	A93S	probably damaging	Het
Cep135	C	T	5: 76,638,193	H1048Y	possibly damaging	Het
Ctnna2	A	G	6: 77,636,713		probably null	Het
Ddx60	T	C	8: 61,942,461	L144P	probably damaging	Het
Dera	A	T	6: 137,780,738	T96S	possibly damaging	Het
Dock9	T	A	14: 121,559,007	M1853L	probably benign	Het
Erbb4	G	A	1: 68,343,921	R306*	probably null	Het
Glyat	G	T	19: 12,651,280	L146F	possibly damaging	Het
Grk4	C	A	5: 34,694,813	Q134K	probably benign	Het
Hkdc1	T	C	10: 62,409,839	Q181R	probably benign	Het
Huwe1	A	T	X: 151,863,959	I682F	probably damaging	Het
Ipo4	C	T	14: 55,630,089		probably benign	Het
Ivl	CCTGCTGCTGCT	CCTGCTGCTGCTGCT	3: 92,571,955		probably benign	Het
Kcnd2	A	G	6: 21,216,396	Q33R	probably benign	Het
Kdm7a	C	T	6: 39,152,823	R473Q	probably damaging	Het
Klhl30	A	T	1: 91,361,031	H504L	probably damaging	Het
Map4	A	G	9: 110,052,371	Y101C	possibly damaging	Het
Mfn2	C	A	4: 147,877,035	R707L	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myof	T	C	19: 37,922,990	N1511D	probably benign	Het
Neb	A	T	2: 52,286,155	Y1431N	probably damaging	Het
Nlrc5	A	G	8: 94,477,146	T625A	probably damaging	Het
Olfr996	G	T	2: 85,579,620	C127F	probably damaging	Het
Pde8a	T	A	7: 81,308,820	Y315*	probably null	Het
Pkhd1	A	T	1: 20,534,719	L1124Q	possibly damaging	Het
Ppp1r3a	A	G	6: 14,754,682	F189L	probably damaging	Het
Prex2	G	A	1: 11,184,545		probably null	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc22a22	T	A	15: 57,263,385	Q77L	probably damaging	Het
Slc24a2	A	T	4: 87,227,397	V140D	probably damaging	Het
Slc35g2	C	A	9: 100,553,234	R128L	probably damaging	Het
Slco1b2	A	G	6: 141,671,167	T409A	probably benign	Het
Spag7	T	C	11: 70,664,990	I80M	probably damaging	Het
Srgap3	A	G	6: 112,781,054	M164T	probably damaging	Het
Sspo	A	T	6: 48,475,534		probably null	Het
Tcte2	T	C	17: 13,722,602		probably benign	Het
Tmem117	A	T	15: 95,094,796	M446L	probably benign	Het
Tmtc4	T	C	14: 122,963,298	T194A	probably benign	Het
Ttc21b	T	C	2: 66,186,218	Y1269C	probably damaging	Het
Zfp236	A	T	18: 82,620,406	I1363N	probably damaging	Het
Zfp760	T	A	17: 21,723,667	S608T	probably benign	Het
Zfp947	G	T	17: 22,146,143	Y183*	probably null	Het

Other mutations in Pax2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01341:Pax2	APN	19	44790688	missense	probably damaging	0.99
IGL02368:Pax2	APN	19	44835409	missense	possibly damaging	0.55
IGL03146:Pax2	APN	19	44833275	splice site	probably benign
R0084:Pax2	UTSW	19	44818435	missense	probably damaging	1.00
R0554:Pax2	UTSW	19	44761861	missense	probably damaging	1.00
R1116:Pax2	UTSW	19	44757424	missense	probably damaging	0.99
R1951:Pax2	UTSW	19	44788832	missense	probably benign	0.09
R1952:Pax2	UTSW	19	44788832	missense	probably benign	0.09
R1981:Pax2	UTSW	19	44818465	missense	probably damaging	1.00
R3015:Pax2	UTSW	19	44816024	missense	probably damaging	1.00
R4320:Pax2	UTSW	19	44835399	missense	probably damaging	0.97
R4562:Pax2	UTSW	19	44835963	missense	unknown
R4661:Pax2	UTSW	19	44760937	missense	probably damaging	1.00
R4948:Pax2	UTSW	19	44816040	missense	probably damaging	1.00
R5131:Pax2	UTSW	19	44760955	missense	probably damaging	0.98
R5622:Pax2	UTSW	19	44818466	missense	probably damaging	1.00
R5661:Pax2	UTSW	19	44790722	missense	probably damaging	1.00
R6110:Pax2	UTSW	19	44790736	missense	probably damaging	0.99
R6171:Pax2	UTSW	19	44790740	missense	probably damaging	1.00
R6713:Pax2	UTSW	19	44835477	missense	unknown
R6791:Pax2	UTSW	19	44788821	missense	possibly damaging	0.69
R7156:Pax2	UTSW	19	44788859	missense	probably benign	0.00
R7679:Pax2	UTSW	19	44760937	missense	probably damaging	1.00
R7695:Pax2	UTSW	19	44833199	missense	probably damaging	1.00
R8005:Pax2	UTSW	19	44760889	missense	probably damaging	1.00
R8555:Pax2	UTSW	19	44761689	missense	probably damaging	1.00
R8849:Pax2	UTSW	19	44760672	intron	probably benign
R8878:Pax2	UTSW	19	44788776	critical splice acceptor site	probably null
R9043:Pax2	UTSW	19	44816060	missense	probably benign	0.00
R9103:Pax2	UTSW	19	44818529	missense	probably benign	0.00
X0018:Pax2	UTSW	19	44796676	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGGATGCAGCACTACTCCTG -3'
(R):5'- GCTGATTGTGTGTCACAGAAAC -3'

Sequencing Primer
(F):5'- AGCACTACTCCTGGGCATCTG -3'
(R):5'- TGTGTCACAGAAACGGCGC -3'

Posted On

2015-09-24