Incidental Mutation 'R4561:Pax2'
ID 343118
Institutional Source Beutler Lab
Gene Symbol Pax2
Ensembl Gene ENSMUSG00000004231
Gene Name paired box 2
Synonyms Opdc, Pax-2
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4561 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 44744484-44826310 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44824402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 374 (Y374C)
Ref Sequence ENSEMBL: ENSMUSP00000134661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000174490]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000004340
AA Change: Y396C
SMART Domains Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: Y396C

DomainStartEndE-ValueType
PAX 15 139 4e-96 SMART
low complexity region 165 177 N/A INTRINSIC
SCOP:d1ftt__ 246 280 1e-4 SMART
Pfam:Pax2_C 300 415 1.1e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174082
Predicted Effect unknown
Transcript: ENSMUST00000174490
AA Change: Y374C
SMART Domains Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: Y374C

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 224 258 8e-5 SMART
Pfam:Pax2_C 278 393 6.3e-57 PFAM
Meta Mutation Damage Score 0.1387 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,848 (GRCm39) S1601P probably damaging Het
Arnt A G 3: 95,359,924 (GRCm39) N56D probably damaging Het
Atad5 A G 11: 79,986,715 (GRCm39) T601A probably benign Het
Calr4 A G 4: 109,103,379 (GRCm39) N163S probably damaging Het
Cenpc1 C A 5: 86,195,491 (GRCm39) A93S probably damaging Het
Cep135 C T 5: 76,786,040 (GRCm39) H1048Y possibly damaging Het
Ctnna2 A G 6: 77,613,696 (GRCm39) probably null Het
Ddx60 T C 8: 62,395,495 (GRCm39) L144P probably damaging Het
Dera A T 6: 137,757,736 (GRCm39) T96S possibly damaging Het
Dock9 T A 14: 121,796,419 (GRCm39) M1853L probably benign Het
Erbb4 G A 1: 68,383,080 (GRCm39) R306* probably null Het
Glyat G T 19: 12,628,644 (GRCm39) L146F possibly damaging Het
Grk4 C A 5: 34,852,157 (GRCm39) Q134K probably benign Het
Hkdc1 T C 10: 62,245,618 (GRCm39) Q181R probably benign Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ipo4 C T 14: 55,867,546 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcnd2 A G 6: 21,216,395 (GRCm39) Q33R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klhl30 A T 1: 91,288,753 (GRCm39) H504L probably damaging Het
Map4 A G 9: 109,881,439 (GRCm39) Y101C possibly damaging Het
Mfn2 C A 4: 147,961,492 (GRCm39) R707L probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myof T C 19: 37,911,438 (GRCm39) N1511D probably benign Het
Neb A T 2: 52,176,167 (GRCm39) Y1431N probably damaging Het
Nlrc5 A G 8: 95,203,774 (GRCm39) T625A probably damaging Het
Or5g27 G T 2: 85,409,964 (GRCm39) C127F probably damaging Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pkhd1 A T 1: 20,604,943 (GRCm39) L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,681 (GRCm39) F189L probably damaging Het
Prex2 G A 1: 11,254,769 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc22a22 T A 15: 57,126,781 (GRCm39) Q77L probably damaging Het
Slc24a2 A T 4: 87,145,634 (GRCm39) V140D probably damaging Het
Slc35g2 C A 9: 100,435,287 (GRCm39) R128L probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Spag7 T C 11: 70,555,816 (GRCm39) I80M probably damaging Het
Srgap3 A G 6: 112,758,015 (GRCm39) M164T probably damaging Het
Sspo A T 6: 48,452,468 (GRCm39) probably null Het
Tcte2 T C 17: 13,942,864 (GRCm39) probably benign Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tmtc4 T C 14: 123,200,710 (GRCm39) T194A probably benign Het
Ttc21b T C 2: 66,016,562 (GRCm39) Y1269C probably damaging Het
Zfp236 A T 18: 82,638,531 (GRCm39) I1363N probably damaging Het
Zfp760 T A 17: 21,942,648 (GRCm39) S608T probably benign Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Pax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Pax2 APN 19 44,779,127 (GRCm39) missense probably damaging 0.99
IGL02368:Pax2 APN 19 44,823,848 (GRCm39) missense possibly damaging 0.55
IGL03146:Pax2 APN 19 44,821,714 (GRCm39) splice site probably benign
R0084:Pax2 UTSW 19 44,806,874 (GRCm39) missense probably damaging 1.00
R0554:Pax2 UTSW 19 44,750,300 (GRCm39) missense probably damaging 1.00
R1116:Pax2 UTSW 19 44,745,863 (GRCm39) missense probably damaging 0.99
R1951:Pax2 UTSW 19 44,777,271 (GRCm39) missense probably benign 0.09
R1952:Pax2 UTSW 19 44,777,271 (GRCm39) missense probably benign 0.09
R1981:Pax2 UTSW 19 44,806,904 (GRCm39) missense probably damaging 1.00
R3015:Pax2 UTSW 19 44,804,463 (GRCm39) missense probably damaging 1.00
R4320:Pax2 UTSW 19 44,823,838 (GRCm39) missense probably damaging 0.97
R4562:Pax2 UTSW 19 44,824,402 (GRCm39) missense unknown
R4661:Pax2 UTSW 19 44,749,376 (GRCm39) missense probably damaging 1.00
R4948:Pax2 UTSW 19 44,804,479 (GRCm39) missense probably damaging 1.00
R5131:Pax2 UTSW 19 44,749,394 (GRCm39) missense probably damaging 0.98
R5622:Pax2 UTSW 19 44,806,905 (GRCm39) missense probably damaging 1.00
R5661:Pax2 UTSW 19 44,779,161 (GRCm39) missense probably damaging 1.00
R6110:Pax2 UTSW 19 44,779,175 (GRCm39) missense probably damaging 0.99
R6171:Pax2 UTSW 19 44,779,179 (GRCm39) missense probably damaging 1.00
R6713:Pax2 UTSW 19 44,823,916 (GRCm39) missense unknown
R6791:Pax2 UTSW 19 44,777,260 (GRCm39) missense possibly damaging 0.69
R7156:Pax2 UTSW 19 44,777,298 (GRCm39) missense probably benign 0.00
R7679:Pax2 UTSW 19 44,749,376 (GRCm39) missense probably damaging 1.00
R7695:Pax2 UTSW 19 44,821,638 (GRCm39) missense probably damaging 1.00
R8005:Pax2 UTSW 19 44,749,328 (GRCm39) missense probably damaging 1.00
R8555:Pax2 UTSW 19 44,750,128 (GRCm39) missense probably damaging 1.00
R8849:Pax2 UTSW 19 44,749,111 (GRCm39) intron probably benign
R8878:Pax2 UTSW 19 44,777,215 (GRCm39) critical splice acceptor site probably null
R9043:Pax2 UTSW 19 44,804,499 (GRCm39) missense probably benign 0.00
R9103:Pax2 UTSW 19 44,806,968 (GRCm39) missense probably benign 0.00
X0018:Pax2 UTSW 19 44,785,115 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGATGCAGCACTACTCCTG -3'
(R):5'- GCTGATTGTGTGTCACAGAAAC -3'

Sequencing Primer
(F):5'- AGCACTACTCCTGGGCATCTG -3'
(R):5'- TGTGTCACAGAAACGGCGC -3'
Posted On 2015-09-24