Incidental Mutation 'R4561:Huwe1'
ID 343119
Institutional Source Beutler Lab
Gene Symbol Huwe1
Ensembl Gene ENSMUSG00000025261
Gene Name HECT, UBA and WWE domain containing 1
Synonyms LOC382250, C430014N20Rik, Ib772, Ureb1, Mule, Arf-bp1, 5430439H10Rik
MMRRC Submission 041786-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4561 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 151800807-151935417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 151863959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 682 (I682F)
Ref Sequence ENSEMBL: ENSMUSP00000108241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026292] [ENSMUST00000112622] [ENSMUST00000123306] [ENSMUST00000153687]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026292
AA Change: I682F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026292
Gene: ENSMUSG00000025261
AA Change: I682F

DomainStartEndE-ValueType
Pfam:DUF908 90 369 4.2e-38 PFAM
Pfam:DUF913 430 814 6.1e-121 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1614 1679 3.5e-16 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2021 2036 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
low complexity region 2131 2143 N/A INTRINSIC
low complexity region 2262 2272 N/A INTRINSIC
low complexity region 2276 2293 N/A INTRINSIC
low complexity region 2348 2358 N/A INTRINSIC
low complexity region 2409 2471 N/A INTRINSIC
low complexity region 2527 2543 N/A INTRINSIC
low complexity region 2591 2601 N/A INTRINSIC
low complexity region 2679 2702 N/A INTRINSIC
low complexity region 2739 2759 N/A INTRINSIC
low complexity region 2766 2781 N/A INTRINSIC
low complexity region 2914 2933 N/A INTRINSIC
low complexity region 2945 2960 N/A INTRINSIC
Pfam:DUF4414 2969 3080 1.3e-32 PFAM
low complexity region 3091 3108 N/A INTRINSIC
low complexity region 3173 3182 N/A INTRINSIC
low complexity region 3224 3239 N/A INTRINSIC
low complexity region 3254 3264 N/A INTRINSIC
low complexity region 3370 3384 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3476 3553 N/A INTRINSIC
low complexity region 3750 3762 N/A INTRINSIC
coiled coil region 3763 3787 N/A INTRINSIC
low complexity region 3838 3860 N/A INTRINSIC
low complexity region 3919 3935 N/A INTRINSIC
HECTc 4040 4378 2.28e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112622
AA Change: I682F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108241
Gene: ENSMUSG00000025261
AA Change: I682F

DomainStartEndE-ValueType
Pfam:DUF908 89 370 1.8e-74 PFAM
Pfam:DUF913 429 815 1.2e-126 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1611 1679 3.5e-14 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2130 2142 N/A INTRINSIC
low complexity region 2261 2271 N/A INTRINSIC
low complexity region 2275 2292 N/A INTRINSIC
low complexity region 2347 2357 N/A INTRINSIC
low complexity region 2408 2470 N/A INTRINSIC
low complexity region 2526 2542 N/A INTRINSIC
low complexity region 2590 2600 N/A INTRINSIC
low complexity region 2678 2701 N/A INTRINSIC
low complexity region 2738 2758 N/A INTRINSIC
low complexity region 2765 2780 N/A INTRINSIC
low complexity region 2913 2932 N/A INTRINSIC
low complexity region 2944 2959 N/A INTRINSIC
Pfam:DUF4414 2968 3079 1.1e-34 PFAM
low complexity region 3090 3107 N/A INTRINSIC
low complexity region 3172 3181 N/A INTRINSIC
low complexity region 3223 3238 N/A INTRINSIC
low complexity region 3253 3263 N/A INTRINSIC
low complexity region 3369 3383 N/A INTRINSIC
low complexity region 3445 3460 N/A INTRINSIC
low complexity region 3475 3552 N/A INTRINSIC
low complexity region 3749 3761 N/A INTRINSIC
coiled coil region 3762 3786 N/A INTRINSIC
low complexity region 3837 3859 N/A INTRINSIC
low complexity region 3918 3934 N/A INTRINSIC
HECTc 4039 4377 2.28e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123306
SMART Domains Protein: ENSMUSP00000118185
Gene: ENSMUSG00000025261

DomainStartEndE-ValueType
Pfam:DUF913 1 132 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131786
Predicted Effect possibly damaging
Transcript: ENSMUST00000138023
AA Change: I185F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120057
Gene: ENSMUSG00000025261
AA Change: I185F

DomainStartEndE-ValueType
Pfam:DUF913 2 318 7.3e-110 PFAM
low complexity region 345 362 N/A INTRINSIC
low complexity region 391 405 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 587 608 N/A INTRINSIC
low complexity region 796 818 N/A INTRINSIC
UBA 822 858 1.3e-4 SMART
low complexity region 901 928 N/A INTRINSIC
low complexity region 1030 1046 N/A INTRINSIC
Pfam:WWE 1118 1176 7.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150020
Predicted Effect probably benign
Transcript: ENSMUST00000153687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175478
Meta Mutation Damage Score 0.7056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C-terminal HECT (E6AP type E3 ubiquitin protein ligase) domain that functions as an E3 ubiquitin ligase. The encoded protein is required for the ubiquitination and subsequent degradation of the anti-apoptotic protein Mcl1 (myeloid cell leukemia sequence 1 (BCL2-related)). This protein also ubiquitinates the p53 tumor suppressor, core histones, and DNA polymerase beta. Mutations in this gene are associated with Turner type X-linked syndromic mental retardation. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons results in neonatal lethality, poorly developed dentate gyrus, small cerebellum, increased cortex density, and increased neuronal precursor cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Huwe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Huwe1 APN X 151885627 missense probably damaging 1.00
IGL00707:Huwe1 APN X 151860734 missense probably damaging 1.00
IGL00932:Huwe1 APN X 151860161 splice site probably benign
IGL01413:Huwe1 APN X 151882680 missense possibly damaging 0.48
IGL01685:Huwe1 APN X 151898670 splice site probably benign
IGL02120:Huwe1 APN X 151907390 missense possibly damaging 0.53
IGL02176:Huwe1 APN X 151903968 missense possibly damaging 0.47
IGL02868:Huwe1 APN X 151908833 missense possibly damaging 0.91
IGL02902:Huwe1 APN X 151886766 missense probably damaging 0.98
IGL02971:Huwe1 APN X 151927626 splice site probably benign
R0650:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0651:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0657:Huwe1 UTSW X 151919928 missense probably benign 0.33
R1241:Huwe1 UTSW X 151907048 small deletion probably benign
R1247:Huwe1 UTSW X 151901570 missense probably benign 0.03
R1791:Huwe1 UTSW X 151864753 missense probably benign 0.06
R4296:Huwe1 UTSW X 151888448 missense probably benign 0.20
R4562:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4563:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R5339:Huwe1 UTSW X 151907048 small deletion probably benign
R8817:Huwe1 UTSW X 151886997 missense probably benign 0.03
R8819:Huwe1 UTSW X 151886997 missense probably benign 0.03
R9026:Huwe1 UTSW X 151933088 missense unknown
R9027:Huwe1 UTSW X 151933088 missense unknown
Z1176:Huwe1 UTSW X 151856575 missense probably damaging 1.00
Z1176:Huwe1 UTSW X 151928381 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTAGATAGTCACAAGAAGCAGTTC -3'
(R):5'- AACTGAAGCCCCTGCATATTTG -3'

Sequencing Primer
(F):5'- CCTTAAGGGGATACTGCATC -3'
(R):5'- GAAGCCCCTGCATATTTGTTAATC -3'
Posted On 2015-09-24