Incidental Mutation 'R4562:Olfr1289'
ID343122
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111483564 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 45 (M45L)
Ref Sequence ENSEMBL: ENSMUSP00000147119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102551] [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably benign
Transcript: ENSMUST00000102551
AA Change: M45L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099611
Gene: ENSMUSG00000108908
AA Change: M45L

DomainStartEndE-ValueType
Pfam:7tm_4 17 289 6e-45 PFAM
Pfam:7TM_GPCR_Srsx 20 288 1.4e-7 PFAM
Pfam:7tm_1 27 273 7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
AA Change: M73L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000207494
AA Change: M45L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Dffb A G 4: 153,965,456 C317R probably damaging Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Esco1 A G 18: 10,595,074 S71P possibly damaging Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
Orc1 T C 4: 108,602,055 probably null Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Usp3 G T 9: 66,520,765 probably benign Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1214:Olfr1289 UTSW 2 111483892 missense probably damaging 1.00
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R1714:Olfr1289 UTSW 2 111483663 missense probably damaging 1.00
R2088:Olfr1289 UTSW 2 111484278 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6960:Olfr1289 UTSW 2 111483726 missense possibly damaging 0.70
R7293:Olfr1289 UTSW 2 111483354 splice site probably null
R7642:Olfr1289 UTSW 2 111483478 missense probably damaging 0.96
R8429:Olfr1289 UTSW 2 111483495 missense possibly damaging 0.55
R8447:Olfr1289 UTSW 2 111483756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTGCAGAGACTCTCTTC -3'
(R):5'- ATCTATCAAAGGCCATGGCTAC -3'

Sequencing Primer
(F):5'- AGTGCAGAGACTCTCTTCTGGAATC -3'
(R):5'- ATGGCTACAAGGGTTACCATCTC -3'
Posted On2015-09-24