Incidental Mutation 'R4562:Orc1'
ID343128
Institutional Source Beutler Lab
Gene Symbol Orc1
Ensembl Gene ENSMUSG00000028587
Gene Nameorigin recognition complex, subunit 1
SynonymsMmORC1, Orc1l
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108579423-108614833 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108602055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102744]
PDB Structure
Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000102744
SMART Domains Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587

DomainStartEndE-ValueType
BAH 44 170 1.88e-31 SMART
low complexity region 394 417 N/A INTRINSIC
AAA 505 656 1e-7 SMART
Cdc6_C 757 837 5.45e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129931
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Dffb A G 4: 153,965,456 C317R probably damaging Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Esco1 A G 18: 10,595,074 S71P possibly damaging Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr1289 A T 2: 111,483,564 M45L probably benign Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Usp3 G T 9: 66,520,765 probably benign Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Orc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Orc1 APN 4 108595325 splice site probably benign
IGL00709:Orc1 APN 4 108590778 critical splice donor site probably null
IGL01124:Orc1 APN 4 108588787 splice site probably benign
IGL01514:Orc1 APN 4 108602052 missense probably damaging 0.97
IGL01677:Orc1 APN 4 108604585 missense probably damaging 1.00
IGL01782:Orc1 APN 4 108606268 missense possibly damaging 0.78
IGL01886:Orc1 APN 4 108603957 splice site probably null
IGL01912:Orc1 APN 4 108590744 missense probably damaging 1.00
IGL02057:Orc1 APN 4 108588729 missense possibly damaging 0.53
IGL02155:Orc1 APN 4 108590677 missense probably benign 0.00
IGL02311:Orc1 APN 4 108599974 missense probably benign
IGL02616:Orc1 APN 4 108595479 missense probably benign 0.00
land_lubber UTSW 4 108588687 start codon destroyed probably damaging 0.99
R0012:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0195:Orc1 UTSW 4 108614308 nonsense probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0611:Orc1 UTSW 4 108602032 missense probably benign
R1351:Orc1 UTSW 4 108595367 missense probably benign 0.01
R1966:Orc1 UTSW 4 108612217 missense probably damaging 1.00
R2018:Orc1 UTSW 4 108590700 missense possibly damaging 0.95
R2398:Orc1 UTSW 4 108601969 missense possibly damaging 0.68
R3110:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3112:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3712:Orc1 UTSW 4 108604021 missense probably damaging 1.00
R3716:Orc1 UTSW 4 108614459 missense probably damaging 1.00
R3829:Orc1 UTSW 4 108605631 missense probably damaging 1.00
R4282:Orc1 UTSW 4 108606274 missense probably benign 0.18
R4320:Orc1 UTSW 4 108588776 missense probably benign
R4321:Orc1 UTSW 4 108588776 missense probably benign
R4322:Orc1 UTSW 4 108588776 missense probably benign
R4348:Orc1 UTSW 4 108593452 missense probably damaging 0.98
R4772:Orc1 UTSW 4 108579568 utr 5 prime probably benign
R4914:Orc1 UTSW 4 108604558 missense probably damaging 1.00
R4964:Orc1 UTSW 4 108614473 makesense probably null
R5219:Orc1 UTSW 4 108590769 missense probably damaging 1.00
R5428:Orc1 UTSW 4 108599940 missense probably benign 0.00
R5655:Orc1 UTSW 4 108593439 missense probably benign 0.09
R5693:Orc1 UTSW 4 108613079 missense probably benign 0.01
R5936:Orc1 UTSW 4 108601983 missense probably benign 0.10
R5960:Orc1 UTSW 4 108606298 missense possibly damaging 0.67
R6294:Orc1 UTSW 4 108590670 missense probably benign 0.01
R6504:Orc1 UTSW 4 108590717 missense probably benign 0.15
R6533:Orc1 UTSW 4 108597447 missense probably benign 0.05
R6775:Orc1 UTSW 4 108603455 missense probably damaging 1.00
R7123:Orc1 UTSW 4 108588687 start codon destroyed probably damaging 0.99
R7156:Orc1 UTSW 4 108595459 missense probably benign 0.00
R7327:Orc1 UTSW 4 108588714 missense probably benign 0.01
R7552:Orc1 UTSW 4 108588754 missense probably benign 0.41
R7842:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7925:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7982:Orc1 UTSW 4 108603371 intron probably null
R8033:Orc1 UTSW 4 108605564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCATGTAGGAGGTAAGACTAC -3'
(R):5'- AATTTTATGGGTTAGGGGAATAGCC -3'

Sequencing Primer
(F):5'- AGACTACCTTTTGTCTTTTGCCAG -3'
(R):5'- CAAAGATCCGGGAGTAAGTTTCCTTG -3'
Posted On2015-09-24