Incidental Mutation 'R0346:Sfxn4'
ID34313
Institutional Source Beutler Lab
Gene Symbol Sfxn4
Ensembl Gene ENSMUSG00000063698
Gene Namesideroflexin 4
Synonyms
MMRRC Submission 038553-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location60837277-60861479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60858673 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 57 (D57E)
Ref Sequence ENSEMBL: ENSMUSP00000118708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080806] [ENSMUST00000124921] [ENSMUST00000135808]
Predicted Effect probably benign
Transcript: ENSMUST00000080806
AA Change: D57E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000124921
AA Change: D57E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000135808
AA Change: D57E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118743
Gene: ENSMUSG00000063698
AA Change: D57E

DomainStartEndE-ValueType
Pfam:Mtc 11 313 2.1e-67 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sideroflexin family. The encoded protein is a transmembrane protein of the inner mitochondrial membrane, and is required for mitochondrial respiratory homeostasis and erythropoiesis. Mutations in this gene are associated with mitochondriopathy and macrocytic anemia. Alternatively spliced transcript variants have been found in this gene. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Sfxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Sfxn4 APN 19 60851014 missense possibly damaging 0.91
IGL01567:Sfxn4 APN 19 60853898 missense probably damaging 1.00
IGL01829:Sfxn4 APN 19 60858734 missense probably damaging 1.00
IGL01903:Sfxn4 APN 19 60858680 missense probably damaging 0.99
IGL01965:Sfxn4 APN 19 60858744 splice site probably benign
IGL03290:Sfxn4 APN 19 60860070 missense probably damaging 1.00
R0550:Sfxn4 UTSW 19 60850945 splice site probably benign
R2228:Sfxn4 UTSW 19 60851020 missense probably damaging 1.00
R2229:Sfxn4 UTSW 19 60851020 missense probably damaging 1.00
R3949:Sfxn4 UTSW 19 60852063 missense probably damaging 1.00
R5074:Sfxn4 UTSW 19 60851012 missense probably damaging 1.00
R6534:Sfxn4 UTSW 19 60839023 missense probably damaging 1.00
R7120:Sfxn4 UTSW 19 60852039 nonsense probably null
R7375:Sfxn4 UTSW 19 60858674 missense probably benign 0.38
R7438:Sfxn4 UTSW 19 60857361 missense probably damaging 0.99
R7440:Sfxn4 UTSW 19 60842204 missense possibly damaging 0.92
R7479:Sfxn4 UTSW 19 60858674 missense possibly damaging 0.74
R7577:Sfxn4 UTSW 19 60853886 missense probably benign 0.21
R7966:Sfxn4 UTSW 19 60858749 splice site probably null
R8058:Sfxn4 UTSW 19 60844252 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGTTGTTGACTCTGTGCCAACTC -3'
(R):5'- TCAAGTGTGGAACTGAAGTGCTGTG -3'

Sequencing Primer
(F):5'- TACTGCCTACAATGGAACGTG -3'
(R):5'- attccagaagagggcatcag -3'
Posted On2013-05-09