Incidental Mutation 'R4562:Tnfsf11'
ID 343163
Institutional Source Beutler Lab
Gene Symbol Tnfsf11
Ensembl Gene ENSMUSG00000022015
Gene Name tumor necrosis factor (ligand) superfamily, member 11
Synonyms Ly109l, Trance, osteoclast differentiation factor, RANKL, OPGL, OPGL, ODF
MMRRC Submission 041787-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.478) question?
Stock # R4562 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 78514886-78545483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78516020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 316 (D316G)
Ref Sequence ENSEMBL: ENSMUSP00000022592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022592]
AlphaFold O35235
PDB Structure CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022592
AA Change: D316G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: D316G

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
TNF 163 312 7.37e-58 SMART
Meta Mutation Damage Score 0.2780 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,120,331 (GRCm39) R25K probably benign Het
Acap1 C T 11: 69,776,177 (GRCm39) probably benign Het
Aox1 T C 1: 58,098,215 (GRCm39) L309P probably damaging Het
Asap2 A G 12: 21,162,094 (GRCm39) D17G probably damaging Het
Atp8b1 A T 18: 64,689,962 (GRCm39) V590D probably damaging Het
Bace2 G A 16: 97,223,180 (GRCm39) R368Q probably damaging Het
Cad G A 5: 31,215,477 (GRCm39) S96N possibly damaging Het
Csmd3 T C 15: 47,763,240 (GRCm39) T1303A probably benign Het
Defa24 A G 8: 22,224,523 (GRCm39) probably benign Het
Dffb A G 4: 154,049,913 (GRCm39) C317R probably damaging Het
Erap1 T C 13: 74,821,778 (GRCm39) V711A probably benign Het
Esco1 A G 18: 10,595,074 (GRCm39) S71P possibly damaging Het
Evpl G A 11: 116,124,225 (GRCm39) T198M possibly damaging Het
Gm10797 A G 10: 67,408,515 (GRCm39) noncoding transcript Het
Gm10822 C T 2: 73,729,833 (GRCm39) noncoding transcript Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Ift22 A G 5: 136,941,724 (GRCm39) E152G probably benign Het
Ighv3-5 T A 12: 114,226,498 (GRCm39) T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,479,262 (GRCm39) probably benign Het
Kcna5 T C 6: 126,511,303 (GRCm39) H275R probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Klf14 G A 6: 30,935,394 (GRCm39) A80V probably damaging Het
Lrrc71 T A 3: 87,652,715 (GRCm39) probably benign Het
Lypd8 T A 11: 58,273,215 (GRCm39) probably null Het
Mef2b G A 8: 70,619,918 (GRCm39) D345N probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtmr10 C T 7: 63,963,907 (GRCm39) T214M possibly damaging Het
Or10g9b A G 9: 39,917,577 (GRCm39) S223P probably damaging Het
Or13g1 A G 7: 85,956,360 (GRCm39) probably benign Het
Or4f4b A T 2: 111,313,909 (GRCm39) M45L probably benign Het
Orc1 T C 4: 108,459,252 (GRCm39) probably null Het
P4htm T C 9: 108,459,195 (GRCm39) S246G probably null Het
Pax2 A G 19: 44,824,402 (GRCm39) Y374C unknown Het
Pde6b A G 5: 108,551,234 (GRCm39) K173E probably benign Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Plekhh2 A G 17: 84,873,525 (GRCm39) D270G probably benign Het
Prr5 A C 15: 84,626,114 (GRCm39) D63A probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Ryr1 C A 7: 28,774,005 (GRCm39) probably benign Het
Slc4a1ap G A 5: 31,689,373 (GRCm39) V347M probably damaging Het
Tasor A G 14: 27,188,265 (GRCm39) T904A possibly damaging Het
Tln1 C A 4: 43,533,598 (GRCm39) A2319S probably damaging Het
Tm6sf1 G A 7: 81,509,209 (GRCm39) A5T probably damaging Het
Tmem117 A T 15: 94,992,677 (GRCm39) M446L probably benign Het
Tnfrsf22 C T 7: 143,203,313 (GRCm39) R19Q unknown Het
Trerf1 G A 17: 47,637,997 (GRCm39) noncoding transcript Het
Ttc13 A G 8: 125,402,016 (GRCm39) L657P probably damaging Het
Unc79 C T 12: 102,957,720 (GRCm39) T45I probably damaging Het
Usp3 G T 9: 66,428,047 (GRCm39) probably benign Het
Vmn2r-ps158 C T 7: 42,672,986 (GRCm39) Q130* probably null Het
Wdr31 A C 4: 62,372,159 (GRCm39) L319W probably damaging Het
Zfp947 G T 17: 22,365,124 (GRCm39) Y183* probably null Het
Other mutations in Tnfsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02601:Tnfsf11 APN 14 78,537,385 (GRCm39) nonsense probably null
R0352:Tnfsf11 UTSW 14 78,516,408 (GRCm39) missense probably benign 0.17
R0377:Tnfsf11 UTSW 14 78,537,352 (GRCm39) missense probably benign 0.00
R2062:Tnfsf11 UTSW 14 78,516,362 (GRCm39) missense probably damaging 1.00
R2121:Tnfsf11 UTSW 14 78,537,333 (GRCm39) missense probably benign 0.32
R2178:Tnfsf11 UTSW 14 78,521,682 (GRCm39) missense probably benign 0.00
R2237:Tnfsf11 UTSW 14 78,537,421 (GRCm39) missense possibly damaging 0.77
R2238:Tnfsf11 UTSW 14 78,537,421 (GRCm39) missense possibly damaging 0.77
R2239:Tnfsf11 UTSW 14 78,537,421 (GRCm39) missense possibly damaging 0.77
R2430:Tnfsf11 UTSW 14 78,521,752 (GRCm39) missense probably benign 0.00
R4155:Tnfsf11 UTSW 14 78,537,309 (GRCm39) missense probably benign 0.28
R4197:Tnfsf11 UTSW 14 78,521,752 (GRCm39) missense probably benign 0.00
R6141:Tnfsf11 UTSW 14 78,545,299 (GRCm39) missense probably damaging 0.99
R8063:Tnfsf11 UTSW 14 78,516,098 (GRCm39) missense probably damaging 1.00
R8904:Tnfsf11 UTSW 14 78,516,119 (GRCm39) missense possibly damaging 0.88
X0020:Tnfsf11 UTSW 14 78,516,317 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTGTGTAATCACCATGAATC -3'
(R):5'- TCTCATAACCTGATGAAAGGAGGG -3'

Sequencing Primer
(F):5'- ACCATGAATCTAACATCACCTATGG -3'
(R):5'- GAGCACGAAAAACTGGTCG -3'
Posted On 2015-09-24