Incidental Mutation 'R4562:Esco1'
ID343172
Institutional Source Beutler Lab
Gene Symbol Esco1
Ensembl Gene ENSMUSG00000024293
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 1
SynonymsA930014I12Rik
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10566602-10610352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10595074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000025142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025142] [ENSMUST00000097670] [ENSMUST00000115864]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025142
AA Change: S71P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025142
Gene: ENSMUSG00000024293
AA Change: S71P

DomainStartEndE-ValueType
coiled coil region 8 32 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Pfam:zf-C2H2_3 607 646 4.7e-17 PFAM
Pfam:Acetyltransf_13 766 834 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097670
SMART Domains Protein: ENSMUSP00000095274
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 108 148 1.7e-19 PFAM
Pfam:Acetyltransf_13 266 335 4.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115864
SMART Domains Protein: ENSMUSP00000111530
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 83 123 1.8e-19 PFAM
Pfam:Acetyltransf_13 241 310 4.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145320
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESCO1 belongs to a conserved family of acetyltransferases involved in sister chromatid cohesion (Hou and Zou, 2005 [PubMed 15958495]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Dffb A G 4: 153,965,456 C317R probably damaging Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr1289 A T 2: 111,483,564 M45L probably benign Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
Orc1 T C 4: 108,602,055 probably null Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Usp3 G T 9: 66,520,765 probably benign Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Esco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Esco1 APN 18 10582078 missense probably damaging 1.00
IGL01376:Esco1 APN 18 10594892 nonsense probably null
IGL01886:Esco1 APN 18 10595262 missense probably damaging 1.00
IGL03171:Esco1 APN 18 10594263 missense probably damaging 1.00
IGL03233:Esco1 APN 18 10574877 missense probably damaging 1.00
PIT4576001:Esco1 UTSW 18 10572093 missense probably damaging 1.00
PIT4585001:Esco1 UTSW 18 10594355 nonsense probably null
R0266:Esco1 UTSW 18 10594605 missense probably benign 0.00
R0445:Esco1 UTSW 18 10574989 missense probably damaging 1.00
R0494:Esco1 UTSW 18 10594940 missense probably benign 0.28
R0965:Esco1 UTSW 18 10567570 missense probably damaging 1.00
R1834:Esco1 UTSW 18 10594350 missense probably damaging 1.00
R2140:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2141:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2142:Esco1 UTSW 18 10574873 critical splice donor site probably null
R4668:Esco1 UTSW 18 10594734 missense possibly damaging 0.60
R5083:Esco1 UTSW 18 10594734 missense probably benign 0.00
R5128:Esco1 UTSW 18 10567468 utr 3 prime probably benign
R5407:Esco1 UTSW 18 10574886 missense probably damaging 1.00
R5454:Esco1 UTSW 18 10584327 missense probably benign
R5870:Esco1 UTSW 18 10593744 critical splice donor site probably null
R5965:Esco1 UTSW 18 10593867 missense possibly damaging 0.94
R6360:Esco1 UTSW 18 10574931 missense probably damaging 1.00
R6390:Esco1 UTSW 18 10567528 missense probably damaging 1.00
R6438:Esco1 UTSW 18 10572031 missense probably damaging 1.00
R6524:Esco1 UTSW 18 10582188 critical splice acceptor site probably null
R6534:Esco1 UTSW 18 10594794 missense possibly damaging 0.90
R6633:Esco1 UTSW 18 10595738 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCGCAAAGACCTGGTTGTAC -3'
(R):5'- TCCTCAGAAAGAAAGACATTACTCAGG -3'

Sequencing Primer
(F):5'- GCAAAGACCTGGTTGTACACTCTG -3'
(R):5'- ACTCAGGAATAATGTCCATTCAGG -3'
Posted On2015-09-24