Incidental Mutation 'R4563:Ncf2'
ID343178
Institutional Source Beutler Lab
Gene Symbol Ncf2
Ensembl Gene ENSMUSG00000026480
Gene Nameneutrophil cytosolic factor 2
SynonymsNOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)
MMRRC Submission 041788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4563 (G1)
Quality Score202
Status Validated
Chromosome1
Chromosomal Location152800194-152836991 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 152808225 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000186568] [ENSMUST00000190323]
Predicted Effect probably benign
Transcript: ENSMUST00000027754
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186568
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189135
Predicted Effect probably benign
Transcript: ENSMUST00000190323
SMART Domains Protein: ENSMUSP00000139774
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
Pfam:TPR_1 1 26 5.8e-4 PFAM
low complexity region 54 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,234,498 M152L probably benign Het
Adam17 A G 12: 21,332,088 C591R probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Calm5 C A 13: 3,854,402 S32* probably null Het
Cln3 G T 7: 126,572,558 S346R probably damaging Het
Dirc2 T C 16: 35,697,942 Y467C probably damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Glipr2 A T 4: 43,977,600 N77Y probably damaging Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Kbtbd2 A G 6: 56,789,279 V37A probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Mcm3 G T 1: 20,809,645 R543S probably benign Het
Mgat4a T C 1: 37,466,579 D43G probably damaging Het
Mphosph8 T C 14: 56,691,000 Y703H probably benign Het
Nek6 T G 2: 38,585,293 V282G probably damaging Het
Nhlrc1 T C 13: 47,014,190 D197G possibly damaging Het
Nup93 G T 8: 94,307,892 V612F probably damaging Het
Olfr1105 C T 2: 87,033,684 C179Y probably damaging Het
Olfr1499 A G 19: 13,815,282 F103L probably benign Het
Pafah1b2 T C 9: 45,976,106 K36E probably damaging Het
Paqr9 A G 9: 95,560,944 E329G probably benign Het
Pclo A G 5: 14,521,369 Q256R probably damaging Het
Pctp A T 11: 89,988,752 D94E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pex14 A T 4: 149,041,768 V41D probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rasal2 T C 1: 157,175,991 K366R probably damaging Het
Rprd1a A C 18: 24,507,103 probably null Het
Senp8 A C 9: 59,750,263 M1R probably null Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Strc T C 2: 121,365,805 T1581A probably benign Het
Tmem117 T C 15: 94,638,154 I23T possibly damaging Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ube4b A G 4: 149,359,165 probably benign Het
Vmn1r125 A G 7: 21,272,383 T69A probably damaging Het
Other mutations in Ncf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Ncf2 APN 1 152808174 missense possibly damaging 0.49
IGL00952:Ncf2 APN 1 152836106 missense probably benign 0.19
IGL01504:Ncf2 APN 1 152833329 missense probably benign 0.00
IGL01693:Ncf2 APN 1 152824323 missense probably benign 0.00
IGL02005:Ncf2 APN 1 152817052 missense possibly damaging 0.73
IGL02041:Ncf2 APN 1 152836120 utr 3 prime probably benign
IGL02327:Ncf2 APN 1 152816993 missense possibly damaging 0.49
IGL02366:Ncf2 APN 1 152835073 missense probably benign
IGL02627:Ncf2 APN 1 152811008 splice site probably benign
R0560:Ncf2 UTSW 1 152821522 missense probably damaging 1.00
R1136:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R1640:Ncf2 UTSW 1 152808033 start codon destroyed probably null 1.00
R1673:Ncf2 UTSW 1 152830479 missense probably benign 0.13
R1836:Ncf2 UTSW 1 152808071 missense probably damaging 1.00
R1873:Ncf2 UTSW 1 152825910 missense probably benign 0.00
R1940:Ncf2 UTSW 1 152834064 splice site probably benign
R1967:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R3405:Ncf2 UTSW 1 152825947 unclassified probably benign
R3406:Ncf2 UTSW 1 152825947 unclassified probably benign
R4501:Ncf2 UTSW 1 152835033 missense probably benign 0.00
R4503:Ncf2 UTSW 1 152833778 missense probably benign 0.20
R5841:Ncf2 UTSW 1 152821518 splice site silent
R6336:Ncf2 UTSW 1 152834070 missense probably damaging 1.00
R6385:Ncf2 UTSW 1 152830422 missense probably benign 0.00
R6522:Ncf2 UTSW 1 152827463 critical splice donor site probably null
R6811:Ncf2 UTSW 1 152836040 missense probably benign 0.00
R7048:Ncf2 UTSW 1 152808170 missense probably benign
X0066:Ncf2 UTSW 1 152810979 start codon destroyed probably null 0.27
Z1177:Ncf2 UTSW 1 152825942 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCCTTCTGGTAAGCAC -3'
(R):5'- GAGATCTCATAAAGAGCAGAGCCC -3'

Sequencing Primer
(F):5'- TTCTGGTAAGCACCTAACCATG -3'
(R):5'- GAGCAGAGCCCCACCCATG -3'
Posted On2015-09-24