Incidental Mutation 'R0058:Sptan1'
ID 34318
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 038352-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0058 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 29965560-30031451 bp(+) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 29993696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000113719] [ENSMUST00000129241] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably null
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100225
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113717
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113719
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113719
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129241
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129241
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184313
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 (GRCm38) V270G probably damaging Het
Acss1 A T 2: 150,628,539 (GRCm38) W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 (GRCm38) V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 (GRCm38) probably benign Het
Anxa1 A T 19: 20,383,777 (GRCm38) Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 (GRCm38) R63C probably damaging Het
Avpr1b A G 1: 131,599,786 (GRCm38) T16A probably benign Het
Bpifb1 G A 2: 154,206,540 (GRCm38) R165H possibly damaging Het
Cables1 A G 18: 11,923,413 (GRCm38) E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 (GRCm38) I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 (GRCm38) D86G probably benign Het
Cgnl1 T A 9: 71,724,840 (GRCm38) R410W probably damaging Het
Cgnl1 C A 9: 71,641,397 (GRCm38) D1081Y probably damaging Het
Cntnap4 G A 8: 112,785,784 (GRCm38) E593K probably damaging Het
Dazap1 T C 10: 80,261,581 (GRCm38) probably benign Het
Dip2b A G 15: 100,215,240 (GRCm38) E1512G probably benign Het
Dock1 G A 7: 135,108,761 (GRCm38) V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 (GRCm38) F1230Y probably benign Het
Dym G A 18: 75,043,172 (GRCm38) E15K possibly damaging Het
Ednra C A 8: 77,667,322 (GRCm38) probably null Het
Faf1 A G 4: 109,736,624 (GRCm38) Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 (GRCm38) I323T probably benign Het
Fcer2a T C 8: 3,688,111 (GRCm38) probably benign Het
Fmo2 A T 1: 162,886,324 (GRCm38) S204R probably benign Het
Frmd4b A G 6: 97,423,499 (GRCm38) V63A probably damaging Het
Fzd8 G A 18: 9,213,985 (GRCm38) A356T possibly damaging Het
Ghitm A G 14: 37,131,592 (GRCm38) L97P probably damaging Het
Gins4 A G 8: 23,229,510 (GRCm38) probably benign Het
Golga3 T A 5: 110,202,777 (GRCm38) F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 (GRCm38) I267T probably benign Het
Helz A T 11: 107,672,558 (GRCm38) probably benign Het
Herc2 T C 7: 56,170,483 (GRCm38) V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 (GRCm38) probably benign Het
Igll1 A T 16: 16,863,876 (GRCm38) V5E probably benign Het
Irx3 T C 8: 91,800,540 (GRCm38) T179A possibly damaging Het
Kif16b A G 2: 142,857,305 (GRCm38) probably null Het
Limk1 A T 5: 134,659,871 (GRCm38) W507R probably damaging Het
Marf1 C T 16: 14,142,534 (GRCm38) A549T probably damaging Het
Mtif3 C A 5: 146,956,921 (GRCm38) V159F probably benign Het
Myh6 C T 14: 54,963,404 (GRCm38) R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 (GRCm38) D887V probably damaging Het
Obox7 C T 7: 14,664,388 (GRCm38) P76S probably benign Het
Or10ak12 A G 4: 118,809,480 (GRCm38) M128T probably benign Het
Or11l3 A T 11: 58,625,668 (GRCm38) I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 (GRCm38) A862V probably damaging Het
Pkd1 G C 17: 24,564,703 (GRCm38) A162P probably benign Het
Plce1 A G 19: 38,525,184 (GRCm38) D309G possibly damaging Het
Plk4 T C 3: 40,805,872 (GRCm38) V401A probably benign Het
Prdx3 T C 19: 60,874,512 (GRCm38) probably benign Het
Prrc2c C T 1: 162,698,884 (GRCm38) V253I unknown Het
Ranbp2 T A 10: 58,480,531 (GRCm38) S2358T probably damaging Het
Setd2 T A 9: 110,594,426 (GRCm38) V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 (GRCm38) S232C probably damaging Het
Skint6 A T 4: 113,046,815 (GRCm38) probably benign Het
Slc15a2 A G 16: 36,754,547 (GRCm38) I531T probably benign Het
Slc36a1 C T 11: 55,221,994 (GRCm38) probably benign Het
Sorbs2 C A 8: 45,796,263 (GRCm38) D831E probably damaging Het
Sorbs2 T A 8: 45,785,254 (GRCm38) probably null Het
Stam T C 2: 14,138,141 (GRCm38) C336R probably damaging Het
Stil G T 4: 115,041,298 (GRCm38) A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 (GRCm38) D773V possibly damaging Het
Sugct A T 13: 17,672,581 (GRCm38) L39Q probably damaging Het
Tep1 A G 14: 50,834,065 (GRCm38) V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 (GRCm38) probably benign Het
Tlr9 T G 9: 106,224,965 (GRCm38) L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 (GRCm38) probably benign Het
Triml2 T C 8: 43,185,269 (GRCm38) probably benign Het
Trip6 A G 5: 137,310,845 (GRCm38) probably benign Het
Tspear T C 10: 77,869,631 (GRCm38) F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 (GRCm38) T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 (GRCm38) S559R possibly damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29,993,956 (GRCm38) critical splice donor site probably null
IGL00932:Sptan1 APN 2 30,015,610 (GRCm38) missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30,000,071 (GRCm38) splice site probably benign
IGL01070:Sptan1 APN 2 30,014,173 (GRCm38) critical splice donor site probably null
IGL01625:Sptan1 APN 2 30,026,114 (GRCm38) missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30,018,479 (GRCm38) missense probably benign 0.12
IGL01795:Sptan1 APN 2 30,018,489 (GRCm38) missense probably benign 0.07
IGL01982:Sptan1 APN 2 30,019,968 (GRCm38) missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30,013,713 (GRCm38) missense probably benign 0.43
IGL02158:Sptan1 APN 2 30,030,324 (GRCm38) missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30,030,740 (GRCm38) missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30,016,055 (GRCm38) missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30,018,474 (GRCm38) missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29,998,183 (GRCm38) missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29,978,576 (GRCm38) missense probably benign 0.03
IGL02725:Sptan1 APN 2 29,996,043 (GRCm38) missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29,991,033 (GRCm38) missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29,986,493 (GRCm38) missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30,025,581 (GRCm38) missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29,993,696 (GRCm38) splice site probably null
R0066:Sptan1 UTSW 2 30,003,667 (GRCm38) splice site probably benign
R0066:Sptan1 UTSW 2 30,003,667 (GRCm38) splice site probably benign
R0071:Sptan1 UTSW 2 30,003,342 (GRCm38) nonsense probably null
R0071:Sptan1 UTSW 2 30,003,342 (GRCm38) nonsense probably null
R0094:Sptan1 UTSW 2 30,006,623 (GRCm38) missense probably benign 0.37
R0230:Sptan1 UTSW 2 30,010,692 (GRCm38) splice site probably benign
R0242:Sptan1 UTSW 2 30,018,401 (GRCm38) missense probably benign 0.00
R0242:Sptan1 UTSW 2 30,018,401 (GRCm38) missense probably benign 0.00
R0366:Sptan1 UTSW 2 29,992,752 (GRCm38) splice site probably null
R0368:Sptan1 UTSW 2 29,993,915 (GRCm38) missense probably benign 0.29
R0396:Sptan1 UTSW 2 29,991,033 (GRCm38) missense probably damaging 1.00
R0423:Sptan1 UTSW 2 30,028,672 (GRCm38) missense probably null
R0448:Sptan1 UTSW 2 30,026,810 (GRCm38) missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30,013,848 (GRCm38) splice site probably benign
R0580:Sptan1 UTSW 2 30,007,575 (GRCm38) missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30,013,518 (GRCm38) missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30,016,028 (GRCm38) missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30,016,028 (GRCm38) missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29,980,063 (GRCm38) splice site probably null
R1352:Sptan1 UTSW 2 30,021,187 (GRCm38) splice site probably benign
R1456:Sptan1 UTSW 2 29,980,203 (GRCm38) critical splice donor site probably null
R1537:Sptan1 UTSW 2 30,026,022 (GRCm38) missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 30,027,127 (GRCm38) missense probably damaging 1.00
R1612:Sptan1 UTSW 2 30,003,336 (GRCm38) missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29,986,420 (GRCm38) missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29,992,001 (GRCm38) splice site probably benign
R1879:Sptan1 UTSW 2 29,995,528 (GRCm38) missense probably damaging 1.00
R1893:Sptan1 UTSW 2 30,020,460 (GRCm38) missense probably damaging 0.98
R1914:Sptan1 UTSW 2 30,011,036 (GRCm38) missense probably benign 0.00
R1915:Sptan1 UTSW 2 30,011,036 (GRCm38) missense probably benign 0.00
R2022:Sptan1 UTSW 2 30,007,561 (GRCm38) missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30,002,238 (GRCm38) missense probably benign
R2103:Sptan1 UTSW 2 30,030,471 (GRCm38) missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30,018,576 (GRCm38) splice site probably benign
R2931:Sptan1 UTSW 2 30,018,488 (GRCm38) missense probably benign
R3726:Sptan1 UTSW 2 30,018,419 (GRCm38) missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30,030,025 (GRCm38) missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30,026,588 (GRCm38) missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30,025,569 (GRCm38) missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30,029,709 (GRCm38) intron probably benign
R4718:Sptan1 UTSW 2 30,031,062 (GRCm38) missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29,996,435 (GRCm38) missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30,011,042 (GRCm38) missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29,978,443 (GRCm38) missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29,993,724 (GRCm38) intron probably benign
R5181:Sptan1 UTSW 2 29,993,724 (GRCm38) intron probably benign
R5383:Sptan1 UTSW 2 30,011,328 (GRCm38) missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29,986,492 (GRCm38) nonsense probably null
R5592:Sptan1 UTSW 2 29,986,719 (GRCm38) intron probably benign
R5639:Sptan1 UTSW 2 29,990,993 (GRCm38) nonsense probably null
R5801:Sptan1 UTSW 2 30,030,601 (GRCm38) splice site probably null
R5947:Sptan1 UTSW 2 29,994,367 (GRCm38) critical splice donor site probably null
R6056:Sptan1 UTSW 2 29,996,782 (GRCm38) missense probably benign 0.36
R6090:Sptan1 UTSW 2 29,993,887 (GRCm38) missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30,004,523 (GRCm38) missense probably benign 0.01
R6254:Sptan1 UTSW 2 30,007,549 (GRCm38) missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30,020,455 (GRCm38) missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30,018,515 (GRCm38) missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30,020,455 (GRCm38) missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30,030,973 (GRCm38) missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29,983,209 (GRCm38) missense probably benign 0.02
R7248:Sptan1 UTSW 2 30,002,299 (GRCm38) missense probably benign 0.10
R7282:Sptan1 UTSW 2 29,986,929 (GRCm38) missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29,980,197 (GRCm38) missense probably damaging 1.00
R7585:Sptan1 UTSW 2 30,000,056 (GRCm38) missense probably benign 0.06
R7779:Sptan1 UTSW 2 30,021,307 (GRCm38) missense probably damaging 1.00
R8051:Sptan1 UTSW 2 30,030,159 (GRCm38) missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29,994,339 (GRCm38) missense probably benign 0.22
R8103:Sptan1 UTSW 2 30,020,043 (GRCm38) missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29,980,200 (GRCm38) missense probably damaging 1.00
R8507:Sptan1 UTSW 2 30,026,584 (GRCm38) missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29,983,732 (GRCm38) missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 30,030,585 (GRCm38) missense probably damaging 0.99
R9206:Sptan1 UTSW 2 30,030,712 (GRCm38) missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29,990,965 (GRCm38) missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 30,020,030 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCAGTCTTCCAGGCATATCCA -3'
(R):5'- CGATGCATGGCTCGCTCATGAA -3'

Sequencing Primer
(F):5'- cagggctacacagggaaac -3'
(R):5'- CTCGCTCATGAAGGGCATTG -3'
Posted On 2013-05-09