Incidental Mutation 'R4563:Lrrc71'
ID343185
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Nameleucine rich repeat containing 71
Synonyms
MMRRC Submission 041788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4563 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87736923-87748625 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 87745408 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172621] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079083
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172621
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174759
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,234,498 M152L probably benign Het
Adam17 A G 12: 21,332,088 C591R probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Calm5 C A 13: 3,854,402 S32* probably null Het
Cln3 G T 7: 126,572,558 S346R probably damaging Het
Dirc2 T C 16: 35,697,942 Y467C probably damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Glipr2 A T 4: 43,977,600 N77Y probably damaging Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Kbtbd2 A G 6: 56,789,279 V37A probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Mcm3 G T 1: 20,809,645 R543S probably benign Het
Mgat4a T C 1: 37,466,579 D43G probably damaging Het
Mphosph8 T C 14: 56,691,000 Y703H probably benign Het
Ncf2 T C 1: 152,808,225 probably benign Het
Nek6 T G 2: 38,585,293 V282G probably damaging Het
Nhlrc1 T C 13: 47,014,190 D197G possibly damaging Het
Nup93 G T 8: 94,307,892 V612F probably damaging Het
Olfr1105 C T 2: 87,033,684 C179Y probably damaging Het
Olfr1499 A G 19: 13,815,282 F103L probably benign Het
Pafah1b2 T C 9: 45,976,106 K36E probably damaging Het
Paqr9 A G 9: 95,560,944 E329G probably benign Het
Pclo A G 5: 14,521,369 Q256R probably damaging Het
Pctp A T 11: 89,988,752 D94E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pex14 A T 4: 149,041,768 V41D probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rasal2 T C 1: 157,175,991 K366R probably damaging Het
Rprd1a A C 18: 24,507,103 probably null Het
Senp8 A C 9: 59,750,263 M1R probably null Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Strc T C 2: 121,365,805 T1581A probably benign Het
Tmem117 T C 15: 94,638,154 I23T possibly damaging Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ube4b A G 4: 149,359,165 probably benign Het
Vmn1r125 A G 7: 21,272,383 T69A probably damaging Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87745224 splice site probably null
IGL02387:Lrrc71 APN 3 87743071 missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87743340 missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87741772 missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87745777 missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87745699 missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87742645 splice site probably null
R1511:Lrrc71 UTSW 3 87745484 missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87741841 missense possibly damaging 0.87
R1987:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R2054:Lrrc71 UTSW 3 87742673 missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87745521 nonsense probably null
R2427:Lrrc71 UTSW 3 87746002 missense probably benign
R3700:Lrrc71 UTSW 3 87745878 splice site probably null
R4073:Lrrc71 UTSW 3 87745262 missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87740991 missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87742836 missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87742665 missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4564:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4724:Lrrc71 UTSW 3 87739174 missense probably damaging 0.97
R4826:Lrrc71 UTSW 3 87743308 missense probably benign 0.33
R5156:Lrrc71 UTSW 3 87745787 missense probably benign 0.07
R5631:Lrrc71 UTSW 3 87739149 missense probably benign 0.00
R6182:Lrrc71 UTSW 3 87745794 missense probably benign 0.41
R6558:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R6885:Lrrc71 UTSW 3 87742620 splice site probably null
R7036:Lrrc71 UTSW 3 87748386 missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87743077 missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87743326 missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87742974 missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87741806 missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87739462 missense probably damaging 1.00
Z1177:Lrrc71 UTSW 3 87742821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTGACCTGAGTGTGGAGG -3'
(R):5'- ACTCATTACGCCAGCGCATC -3'

Sequencing Primer
(F):5'- TGACCTGAGTGTGGAGGAACAAAG -3'
(R):5'- TCACGGGCTCACAATTCATG -3'
Posted On2015-09-24