Incidental Mutation 'R4563:Kdm7a'
ID343192
Institutional Source Beutler Lab
Gene Symbol Kdm7a
Ensembl Gene ENSMUSG00000042599
Gene Namelysine (K)-specific demethylase 7A
SynonymsKdm7a, Jhdm1d, ENSMUSG00000073143, A630082K20Rik
MMRRC Submission 041788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4563 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39136623-39206789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39152823 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 473 (R473Q)
Ref Sequence ENSEMBL: ENSMUSP00000002305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002305]
Predicted Effect probably damaging
Transcript: ENSMUST00000002305
AA Change: R473Q

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002305
Gene: ENSMUSG00000042599
AA Change: R473Q

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
PHD 39 86 8.64e-9 SMART
low complexity region 186 197 N/A INTRINSIC
JmjC 230 386 1.09e-49 SMART
low complexity region 408 419 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146981
Meta Mutation Damage Score 0.3989 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicle, tail, sebaceous gland, rib, and vertebrae morphology and decreased circulating iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,234,498 M152L probably benign Het
Adam17 A G 12: 21,332,088 C591R probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Calm5 C A 13: 3,854,402 S32* probably null Het
Cln3 G T 7: 126,572,558 S346R probably damaging Het
Dirc2 T C 16: 35,697,942 Y467C probably damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Glipr2 A T 4: 43,977,600 N77Y probably damaging Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Kbtbd2 A G 6: 56,789,279 V37A probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Mcm3 G T 1: 20,809,645 R543S probably benign Het
Mgat4a T C 1: 37,466,579 D43G probably damaging Het
Mphosph8 T C 14: 56,691,000 Y703H probably benign Het
Ncf2 T C 1: 152,808,225 probably benign Het
Nek6 T G 2: 38,585,293 V282G probably damaging Het
Nhlrc1 T C 13: 47,014,190 D197G possibly damaging Het
Nup93 G T 8: 94,307,892 V612F probably damaging Het
Olfr1105 C T 2: 87,033,684 C179Y probably damaging Het
Olfr1499 A G 19: 13,815,282 F103L probably benign Het
Pafah1b2 T C 9: 45,976,106 K36E probably damaging Het
Paqr9 A G 9: 95,560,944 E329G probably benign Het
Pclo A G 5: 14,521,369 Q256R probably damaging Het
Pctp A T 11: 89,988,752 D94E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pex14 A T 4: 149,041,768 V41D probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rasal2 T C 1: 157,175,991 K366R probably damaging Het
Rprd1a A C 18: 24,507,103 probably null Het
Senp8 A C 9: 59,750,263 M1R probably null Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Strc T C 2: 121,365,805 T1581A probably benign Het
Tmem117 T C 15: 94,638,154 I23T possibly damaging Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ube4b A G 4: 149,359,165 probably benign Het
Vmn1r125 A G 7: 21,272,383 T69A probably damaging Het
Other mutations in Kdm7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kdm7a APN 6 39144510 missense probably benign
IGL00976:Kdm7a APN 6 39144398 missense possibly damaging 0.90
IGL01063:Kdm7a APN 6 39165130 missense probably damaging 0.98
IGL01325:Kdm7a APN 6 39158309 splice site probably benign
IGL01710:Kdm7a APN 6 39175386 missense probably benign 0.06
IGL01953:Kdm7a APN 6 39146902 missense probably benign 0.10
IGL02336:Kdm7a APN 6 39170264 missense probably damaging 1.00
IGL02721:Kdm7a APN 6 39173437 missense possibly damaging 0.93
IGL02963:Kdm7a APN 6 39143230 missense probably damaging 1.00
IGL03165:Kdm7a APN 6 39170914 splice site probably benign
R0033:Kdm7a UTSW 6 39165197 nonsense probably null
R0831:Kdm7a UTSW 6 39166765 splice site probably benign
R0920:Kdm7a UTSW 6 39151322 missense probably damaging 1.00
R0962:Kdm7a UTSW 6 39147194 missense probably benign 0.05
R1403:Kdm7a UTSW 6 39151253 splice site probably benign
R1632:Kdm7a UTSW 6 39152898 missense probably benign 0.15
R1759:Kdm7a UTSW 6 39147699 splice site probably null
R2143:Kdm7a UTSW 6 39168950 missense possibly damaging 0.61
R2197:Kdm7a UTSW 6 39146936 missense probably damaging 0.98
R2496:Kdm7a UTSW 6 39170763 splice site probably null
R3844:Kdm7a UTSW 6 39181579 missense probably damaging 1.00
R4083:Kdm7a UTSW 6 39152814 missense probably damaging 1.00
R4184:Kdm7a UTSW 6 39148977 missense probably benign
R4193:Kdm7a UTSW 6 39169096 missense probably damaging 1.00
R4402:Kdm7a UTSW 6 39166668 missense probably null 1.00
R4544:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4546:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4560:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4561:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4562:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4737:Kdm7a UTSW 6 39152839 missense possibly damaging 0.57
R5061:Kdm7a UTSW 6 39151452 missense possibly damaging 0.88
R5247:Kdm7a UTSW 6 39144456 missense probably benign 0.00
R5430:Kdm7a UTSW 6 39149342 missense possibly damaging 0.85
R6248:Kdm7a UTSW 6 39147049 missense possibly damaging 0.63
R6254:Kdm7a UTSW 6 39170269 missense probably damaging 1.00
R6346:Kdm7a UTSW 6 39151211 intron probably null
R6420:Kdm7a UTSW 6 39165168 missense probably damaging 1.00
R6908:Kdm7a UTSW 6 39144439 missense possibly damaging 0.79
R6966:Kdm7a UTSW 6 39152839 missense probably damaging 1.00
R7048:Kdm7a UTSW 6 39169048 missense probably damaging 1.00
R7087:Kdm7a UTSW 6 39175381 missense probably benign 0.18
R7450:Kdm7a UTSW 6 39143251 missense probably damaging 1.00
R7737:Kdm7a UTSW 6 39144404 missense probably benign 0.03
RF012:Kdm7a UTSW 6 39206513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTGCCTCTGTTGTTTTATAAC -3'
(R):5'- AGATTCACTGTGAGGCAAATCC -3'

Sequencing Primer
(F):5'- ACTTCACACGTGTCAGTG -3'
(R):5'- CCTCCTAGCTATTGGGATTAAAGGC -3'
Posted On2015-09-24