Incidental Mutation 'R4563:Nup93'
ID 343200
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
MMRRC Submission 041788-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # R4563 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 94941192-95043855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 95034520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 612 (V612F)
Ref Sequence ENSEMBL: ENSMUSP00000148700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably damaging
Transcript: ENSMUST00000079961
AA Change: V612F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: V612F

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109547
AA Change: V612F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: V612F

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211822
AA Change: V489F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212824
AA Change: V612F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212984
Meta Mutation Damage Score 0.7654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,382,089 (GRCm39) C591R probably damaging Het
Bace2 G A 16: 97,223,180 (GRCm39) R368Q probably damaging Het
Calm5 C A 13: 3,904,402 (GRCm39) S32* probably null Het
Ccdc198 T A 14: 49,471,955 (GRCm39) M152L probably benign Het
Cln3 G T 7: 126,171,730 (GRCm39) S346R probably damaging Het
G6pd2 G A 5: 61,967,686 (GRCm39) R487H possibly damaging Het
Glipr2 A T 4: 43,977,600 (GRCm39) N77Y probably damaging Het
Huwe1 A T X: 150,646,955 (GRCm39) I682F probably damaging Het
Kbtbd2 A G 6: 56,766,264 (GRCm39) V37A probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Lrrc71 T A 3: 87,652,715 (GRCm39) probably benign Het
Mcm3 G T 1: 20,879,869 (GRCm39) R543S probably benign Het
Mgat4a T C 1: 37,505,660 (GRCm39) D43G probably damaging Het
Mphosph8 T C 14: 56,928,457 (GRCm39) Y703H probably benign Het
Ncf2 T C 1: 152,683,976 (GRCm39) probably benign Het
Nek6 T G 2: 38,475,305 (GRCm39) V282G probably damaging Het
Nhlrc1 T C 13: 47,167,666 (GRCm39) D197G possibly damaging Het
Or5be3 C T 2: 86,864,028 (GRCm39) C179Y probably damaging Het
Or9i14 A G 19: 13,792,646 (GRCm39) F103L probably benign Het
Pafah1b2 T C 9: 45,887,404 (GRCm39) K36E probably damaging Het
Paqr9 A G 9: 95,442,997 (GRCm39) E329G probably benign Het
Pclo A G 5: 14,571,383 (GRCm39) Q256R probably damaging Het
Pctp A T 11: 89,879,578 (GRCm39) D94E probably benign Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pex14 A T 4: 149,126,225 (GRCm39) V41D probably damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Rasal2 T C 1: 157,003,561 (GRCm39) K366R probably damaging Het
Rprd1a A C 18: 24,640,160 (GRCm39) probably null Het
Senp8 A C 9: 59,657,546 (GRCm39) M1R probably null Het
Slc49a4 T C 16: 35,518,312 (GRCm39) Y467C probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Strc T C 2: 121,196,286 (GRCm39) T1581A probably benign Het
Tmem117 T C 15: 94,536,035 (GRCm39) I23T possibly damaging Het
Ttc13 A G 8: 125,402,016 (GRCm39) L657P probably damaging Het
Ube4b A G 4: 149,443,622 (GRCm39) probably benign Het
Vmn1r125 A G 7: 21,006,308 (GRCm39) T69A probably damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 95,035,651 (GRCm39) critical splice donor site probably null
IGL01652:Nup93 APN 8 95,023,187 (GRCm39) missense possibly damaging 0.93
IGL02003:Nup93 APN 8 95,028,737 (GRCm39) nonsense probably null
IGL02169:Nup93 APN 8 95,028,757 (GRCm39) missense probably damaging 1.00
IGL02212:Nup93 APN 8 95,038,290 (GRCm39) critical splice donor site probably null
IGL02551:Nup93 APN 8 94,954,461 (GRCm39) nonsense probably null
IGL02568:Nup93 APN 8 95,036,263 (GRCm39) missense probably damaging 1.00
IGL03094:Nup93 APN 8 95,023,130 (GRCm39) missense probably benign
IGL03248:Nup93 APN 8 95,032,716 (GRCm39) missense probably damaging 0.98
IGL03273:Nup93 APN 8 95,032,905 (GRCm39) missense probably benign 0.01
IGL03401:Nup93 APN 8 95,036,339 (GRCm39) splice site probably null
PIT4585001:Nup93 UTSW 8 94,970,355 (GRCm39) missense probably benign 0.25
R0409:Nup93 UTSW 8 95,030,293 (GRCm39) missense probably damaging 1.00
R0748:Nup93 UTSW 8 95,034,571 (GRCm39) missense probably damaging 1.00
R0891:Nup93 UTSW 8 95,007,891 (GRCm39) splice site probably benign
R1667:Nup93 UTSW 8 95,019,315 (GRCm39) missense possibly damaging 0.71
R1696:Nup93 UTSW 8 95,023,183 (GRCm39) missense probably benign 0.29
R1862:Nup93 UTSW 8 95,032,730 (GRCm39) missense probably damaging 1.00
R2069:Nup93 UTSW 8 94,970,367 (GRCm39) missense probably damaging 1.00
R2143:Nup93 UTSW 8 95,023,108 (GRCm39) nonsense probably null
R2187:Nup93 UTSW 8 95,027,478 (GRCm39) missense probably damaging 1.00
R2228:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2229:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2254:Nup93 UTSW 8 94,954,485 (GRCm39) critical splice donor site probably null
R2884:Nup93 UTSW 8 95,030,266 (GRCm39) missense probably damaging 1.00
R4521:Nup93 UTSW 8 95,041,264 (GRCm39) missense probably damaging 1.00
R4900:Nup93 UTSW 8 95,013,231 (GRCm39) missense probably benign 0.25
R5570:Nup93 UTSW 8 95,041,298 (GRCm39) missense probably damaging 1.00
R6226:Nup93 UTSW 8 95,013,165 (GRCm39) missense probably damaging 1.00
R6489:Nup93 UTSW 8 95,028,716 (GRCm39) missense probably benign 0.10
R6658:Nup93 UTSW 8 95,030,807 (GRCm39) missense probably benign 0.02
R6817:Nup93 UTSW 8 95,041,310 (GRCm39) critical splice donor site probably null
R6895:Nup93 UTSW 8 94,970,314 (GRCm39) missense probably damaging 1.00
R6955:Nup93 UTSW 8 95,036,301 (GRCm39) missense probably damaging 0.96
R7476:Nup93 UTSW 8 95,030,260 (GRCm39) missense probably damaging 1.00
R7643:Nup93 UTSW 8 95,013,247 (GRCm39) critical splice donor site probably null
R7994:Nup93 UTSW 8 95,032,930 (GRCm39) missense probably benign 0.15
R8461:Nup93 UTSW 8 95,007,963 (GRCm39) critical splice donor site probably null
R9177:Nup93 UTSW 8 94,954,371 (GRCm39) missense probably benign 0.25
R9264:Nup93 UTSW 8 95,019,348 (GRCm39) missense probably benign 0.01
R9532:Nup93 UTSW 8 95,041,249 (GRCm39) missense probably damaging 1.00
R9567:Nup93 UTSW 8 95,035,604 (GRCm39) missense possibly damaging 0.94
R9629:Nup93 UTSW 8 95,033,267 (GRCm39) missense probably damaging 0.99
R9721:Nup93 UTSW 8 95,030,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTATGTCTTCAGGAGAGC -3'
(R):5'- TGGCCATAGATACTTTTCGGACAG -3'

Sequencing Primer
(F):5'- ATGTCTTCAGGAGAGCCGAGTC -3'
(R):5'- CTGTAAAATGGGAACTTGACCCTG -3'
Posted On 2015-09-24