Incidental Mutation 'R0058:Bpifb1'
ID34321
Institutional Source Beutler Lab
Gene Symbol Bpifb1
Ensembl Gene ENSMUSG00000027485
Gene NameBPI fold containing family B, member 1
SynonymsLPlunc1, von Ebner minor salivary protein, U46068
MMRRC Submission 038352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0058 (G1)
Quality Score173
Status Validated
Chromosome2
Chromosomal Location154190818-154220369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154206540 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 165 (R165H)
Ref Sequence ENSEMBL: ENSMUSP00000080501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028987] [ENSMUST00000081816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028987
AA Change: R165H

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028987
Gene: ENSMUSG00000027485
AA Change: R165H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081816
AA Change: R165H

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080501
Gene: ENSMUSG00000027485
AA Change: R165H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123017
Meta Mutation Damage Score 0.1427 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background sensitive transmission ratio distortion and increased basal MUC5B production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Faf1 A G 4: 109,736,624 Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Golga3 T A 5: 110,202,777 F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Olfr323 A T 11: 58,625,668 I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Prrc2c C T 1: 162,698,884 V253I unknown Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stam T C 2: 14,138,141 C336R probably damaging Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Tspear T C 10: 77,869,631 F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Bpifb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Bpifb1 APN 2 154217167 splice site probably benign
IGL01516:Bpifb1 APN 2 154218252 missense probably benign 0.03
IGL02047:Bpifb1 APN 2 154202616 start codon destroyed probably null 1.00
IGL02143:Bpifb1 APN 2 154209929 missense probably benign 0.14
IGL03174:Bpifb1 APN 2 154213049 missense probably damaging 1.00
IGL03263:Bpifb1 APN 2 154215306 missense probably benign 0.03
Ectoplasm UTSW 2 154211581 nonsense probably null
R0269:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0617:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0786:Bpifb1 UTSW 2 154202661 missense probably benign 0.11
R1718:Bpifb1 UTSW 2 154213983 splice site probably null
R3605:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3607:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3689:Bpifb1 UTSW 2 154209899 missense probably benign 0.42
R3807:Bpifb1 UTSW 2 154214002 missense probably benign 0.25
R3930:Bpifb1 UTSW 2 154215322 missense possibly damaging 0.89
R4024:Bpifb1 UTSW 2 154213046 missense probably damaging 1.00
R4745:Bpifb1 UTSW 2 154211581 nonsense probably null
R4752:Bpifb1 UTSW 2 154216280 intron probably benign
R5505:Bpifb1 UTSW 2 154204779 missense probably benign 0.00
R5724:Bpifb1 UTSW 2 154204792 missense probably benign
R6281:Bpifb1 UTSW 2 154206465 missense probably damaging 1.00
R7038:Bpifb1 UTSW 2 154202669 missense probably damaging 0.99
R7246:Bpifb1 UTSW 2 154207092 missense probably damaging 1.00
R7540:Bpifb1 UTSW 2 154213111 missense probably damaging 1.00
R7599:Bpifb1 UTSW 2 154214151 missense probably damaging 1.00
R7678:Bpifb1 UTSW 2 154202729 missense possibly damaging 0.74
R7811:Bpifb1 UTSW 2 154206564 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTGACTTGGAATCCCCTGGCATC -3'
(R):5'- ACCCAGAACTGCCTTTGGCATC -3'

Sequencing Primer
(F):5'- gaaccagcaaaagagatagtgaag -3'
(R):5'- CTGGATTCCCTGGAAGGAGC -3'
Posted On2013-05-09