Incidental Mutation 'R4563:Bace2'
ID343212
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Namebeta-site APP-cleaving enzyme 2
Synonyms1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 041788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4563 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97356742-97442936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97421980 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 368 (R368Q)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275] [ENSMUST00000231664]
Predicted Effect probably damaging
Transcript: ENSMUST00000047275
AA Change: R368Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: R368Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231783
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,234,498 M152L probably benign Het
Adam17 A G 12: 21,332,088 C591R probably damaging Het
Calm5 C A 13: 3,854,402 S32* probably null Het
Cln3 G T 7: 126,572,558 S346R probably damaging Het
Dirc2 T C 16: 35,697,942 Y467C probably damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Glipr2 A T 4: 43,977,600 N77Y probably damaging Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Kbtbd2 A G 6: 56,789,279 V37A probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Mcm3 G T 1: 20,809,645 R543S probably benign Het
Mgat4a T C 1: 37,466,579 D43G probably damaging Het
Mphosph8 T C 14: 56,691,000 Y703H probably benign Het
Ncf2 T C 1: 152,808,225 probably benign Het
Nek6 T G 2: 38,585,293 V282G probably damaging Het
Nhlrc1 T C 13: 47,014,190 D197G possibly damaging Het
Nup93 G T 8: 94,307,892 V612F probably damaging Het
Olfr1105 C T 2: 87,033,684 C179Y probably damaging Het
Olfr1499 A G 19: 13,815,282 F103L probably benign Het
Pafah1b2 T C 9: 45,976,106 K36E probably damaging Het
Paqr9 A G 9: 95,560,944 E329G probably benign Het
Pclo A G 5: 14,521,369 Q256R probably damaging Het
Pctp A T 11: 89,988,752 D94E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pex14 A T 4: 149,041,768 V41D probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rasal2 T C 1: 157,175,991 K366R probably damaging Het
Rprd1a A C 18: 24,507,103 probably null Het
Senp8 A C 9: 59,750,263 M1R probably null Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Strc T C 2: 121,365,805 T1581A probably benign Het
Tmem117 T C 15: 94,638,154 I23T possibly damaging Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ube4b A G 4: 149,359,165 probably benign Het
Vmn1r125 A G 7: 21,272,383 T69A probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97408430 missense probably damaging 0.97
IGL02660:Bace2 APN 16 97415140 missense probably damaging 1.00
IGL02669:Bace2 APN 16 97436893 makesense probably null
R0244:Bace2 UTSW 16 97436773 splice site probably null
R0674:Bace2 UTSW 16 97436749 missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97356941 missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97356860 missense unknown
R1670:Bace2 UTSW 16 97412135 missense probably damaging 0.96
R1997:Bace2 UTSW 16 97415089 missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97412136 missense probably damaging 1.00
R2937:Bace2 UTSW 16 97412188 critical splice donor site probably null
R2938:Bace2 UTSW 16 97412188 critical splice donor site probably null
R3103:Bace2 UTSW 16 97422001 critical splice donor site probably null
R3755:Bace2 UTSW 16 97436657 missense probably benign 0.34
R4110:Bace2 UTSW 16 97436656 missense probably benign
R4112:Bace2 UTSW 16 97436656 missense probably benign
R4113:Bace2 UTSW 16 97436656 missense probably benign
R4560:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4562:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4717:Bace2 UTSW 16 97436873 missense probably damaging 1.00
R5535:Bace2 UTSW 16 97413425 missense probably damaging 1.00
R6282:Bace2 UTSW 16 97415097 missense probably damaging 1.00
R6364:Bace2 UTSW 16 97413433 missense probably benign 0.05
R7045:Bace2 UTSW 16 97399665 missense probably damaging 1.00
R7241:Bace2 UTSW 16 97436798 missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97399682 missense probably benign 0.01
R7653:Bace2 UTSW 16 97436652 missense
R8026:Bace2 UTSW 16 97436852 missense probably benign 0.26
R8171:Bace2 UTSW 16 97424586 missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97413470 missense probably damaging 1.00
X0024:Bace2 UTSW 16 97413398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGAGAGCTGTTTCCTG -3'
(R):5'- GTGAGACCATAACATCCCAGGC -3'

Sequencing Primer
(F):5'- AACGGAGAGCTGTTTCCTGTTATG -3'
(R):5'- CCCAGGCTTAAGTTAAGACATGTTC -3'
Posted On2015-09-24