Incidental Mutation 'R4563:Huwe1'
ID 343215
Institutional Source Beutler Lab
Gene Symbol Huwe1
Ensembl Gene ENSMUSG00000025261
Gene Name HECT, UBA and WWE domain containing 1
Synonyms Arf-bp1, Mule, Ureb1, LOC382250, 5430439H10Rik, Ib772, C430014N20Rik
MMRRC Submission 041788-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4563 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 150583803-150718413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 150646955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 682 (I682F)
Ref Sequence ENSEMBL: ENSMUSP00000108241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026292] [ENSMUST00000112622] [ENSMUST00000123306] [ENSMUST00000153687]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026292
AA Change: I682F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026292
Gene: ENSMUSG00000025261
AA Change: I682F

DomainStartEndE-ValueType
Pfam:DUF908 90 369 4.2e-38 PFAM
Pfam:DUF913 430 814 6.1e-121 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1614 1679 3.5e-16 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2021 2036 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
low complexity region 2131 2143 N/A INTRINSIC
low complexity region 2262 2272 N/A INTRINSIC
low complexity region 2276 2293 N/A INTRINSIC
low complexity region 2348 2358 N/A INTRINSIC
low complexity region 2409 2471 N/A INTRINSIC
low complexity region 2527 2543 N/A INTRINSIC
low complexity region 2591 2601 N/A INTRINSIC
low complexity region 2679 2702 N/A INTRINSIC
low complexity region 2739 2759 N/A INTRINSIC
low complexity region 2766 2781 N/A INTRINSIC
low complexity region 2914 2933 N/A INTRINSIC
low complexity region 2945 2960 N/A INTRINSIC
Pfam:DUF4414 2969 3080 1.3e-32 PFAM
low complexity region 3091 3108 N/A INTRINSIC
low complexity region 3173 3182 N/A INTRINSIC
low complexity region 3224 3239 N/A INTRINSIC
low complexity region 3254 3264 N/A INTRINSIC
low complexity region 3370 3384 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3476 3553 N/A INTRINSIC
low complexity region 3750 3762 N/A INTRINSIC
coiled coil region 3763 3787 N/A INTRINSIC
low complexity region 3838 3860 N/A INTRINSIC
low complexity region 3919 3935 N/A INTRINSIC
HECTc 4040 4378 2.28e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112622
AA Change: I682F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108241
Gene: ENSMUSG00000025261
AA Change: I682F

DomainStartEndE-ValueType
Pfam:DUF908 89 370 1.8e-74 PFAM
Pfam:DUF913 429 815 1.2e-126 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1611 1679 3.5e-14 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2130 2142 N/A INTRINSIC
low complexity region 2261 2271 N/A INTRINSIC
low complexity region 2275 2292 N/A INTRINSIC
low complexity region 2347 2357 N/A INTRINSIC
low complexity region 2408 2470 N/A INTRINSIC
low complexity region 2526 2542 N/A INTRINSIC
low complexity region 2590 2600 N/A INTRINSIC
low complexity region 2678 2701 N/A INTRINSIC
low complexity region 2738 2758 N/A INTRINSIC
low complexity region 2765 2780 N/A INTRINSIC
low complexity region 2913 2932 N/A INTRINSIC
low complexity region 2944 2959 N/A INTRINSIC
Pfam:DUF4414 2968 3079 1.1e-34 PFAM
low complexity region 3090 3107 N/A INTRINSIC
low complexity region 3172 3181 N/A INTRINSIC
low complexity region 3223 3238 N/A INTRINSIC
low complexity region 3253 3263 N/A INTRINSIC
low complexity region 3369 3383 N/A INTRINSIC
low complexity region 3445 3460 N/A INTRINSIC
low complexity region 3475 3552 N/A INTRINSIC
low complexity region 3749 3761 N/A INTRINSIC
coiled coil region 3762 3786 N/A INTRINSIC
low complexity region 3837 3859 N/A INTRINSIC
low complexity region 3918 3934 N/A INTRINSIC
HECTc 4039 4377 2.28e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123306
SMART Domains Protein: ENSMUSP00000118185
Gene: ENSMUSG00000025261

DomainStartEndE-ValueType
Pfam:DUF913 1 132 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131786
Predicted Effect possibly damaging
Transcript: ENSMUST00000138023
AA Change: I185F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120057
Gene: ENSMUSG00000025261
AA Change: I185F

DomainStartEndE-ValueType
Pfam:DUF913 2 318 7.3e-110 PFAM
low complexity region 345 362 N/A INTRINSIC
low complexity region 391 405 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 587 608 N/A INTRINSIC
low complexity region 796 818 N/A INTRINSIC
UBA 822 858 1.3e-4 SMART
low complexity region 901 928 N/A INTRINSIC
low complexity region 1030 1046 N/A INTRINSIC
Pfam:WWE 1118 1176 7.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175478
Predicted Effect probably benign
Transcript: ENSMUST00000153687
Meta Mutation Damage Score 0.7056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C-terminal HECT (E6AP type E3 ubiquitin protein ligase) domain that functions as an E3 ubiquitin ligase. The encoded protein is required for the ubiquitination and subsequent degradation of the anti-apoptotic protein Mcl1 (myeloid cell leukemia sequence 1 (BCL2-related)). This protein also ubiquitinates the p53 tumor suppressor, core histones, and DNA polymerase beta. Mutations in this gene are associated with Turner type X-linked syndromic mental retardation. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons results in neonatal lethality, poorly developed dentate gyrus, small cerebellum, increased cortex density, and increased neuronal precursor cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,382,089 (GRCm39) C591R probably damaging Het
Bace2 G A 16: 97,223,180 (GRCm39) R368Q probably damaging Het
Calm5 C A 13: 3,904,402 (GRCm39) S32* probably null Het
Ccdc198 T A 14: 49,471,955 (GRCm39) M152L probably benign Het
Cln3 G T 7: 126,171,730 (GRCm39) S346R probably damaging Het
G6pd2 G A 5: 61,967,686 (GRCm39) R487H possibly damaging Het
Glipr2 A T 4: 43,977,600 (GRCm39) N77Y probably damaging Het
Kbtbd2 A G 6: 56,766,264 (GRCm39) V37A probably benign Het
Kdm7a C T 6: 39,129,757 (GRCm39) R473Q probably damaging Het
Lrrc71 T A 3: 87,652,715 (GRCm39) probably benign Het
Mcm3 G T 1: 20,879,869 (GRCm39) R543S probably benign Het
Mgat4a T C 1: 37,505,660 (GRCm39) D43G probably damaging Het
Mphosph8 T C 14: 56,928,457 (GRCm39) Y703H probably benign Het
Ncf2 T C 1: 152,683,976 (GRCm39) probably benign Het
Nek6 T G 2: 38,475,305 (GRCm39) V282G probably damaging Het
Nhlrc1 T C 13: 47,167,666 (GRCm39) D197G possibly damaging Het
Nup93 G T 8: 95,034,520 (GRCm39) V612F probably damaging Het
Or5be3 C T 2: 86,864,028 (GRCm39) C179Y probably damaging Het
Or9i14 A G 19: 13,792,646 (GRCm39) F103L probably benign Het
Pafah1b2 T C 9: 45,887,404 (GRCm39) K36E probably damaging Het
Paqr9 A G 9: 95,442,997 (GRCm39) E329G probably benign Het
Pclo A G 5: 14,571,383 (GRCm39) Q256R probably damaging Het
Pctp A T 11: 89,879,578 (GRCm39) D94E probably benign Het
Pde8a T A 7: 80,958,568 (GRCm39) Y315* probably null Het
Pex14 A T 4: 149,126,225 (GRCm39) V41D probably damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Rasal2 T C 1: 157,003,561 (GRCm39) K366R probably damaging Het
Rprd1a A C 18: 24,640,160 (GRCm39) probably null Het
Senp8 A C 9: 59,657,546 (GRCm39) M1R probably null Het
Slc49a4 T C 16: 35,518,312 (GRCm39) Y467C probably damaging Het
Slco1b2 A G 6: 141,616,893 (GRCm39) T409A probably benign Het
Strc T C 2: 121,196,286 (GRCm39) T1581A probably benign Het
Tmem117 T C 15: 94,536,035 (GRCm39) I23T possibly damaging Het
Ttc13 A G 8: 125,402,016 (GRCm39) L657P probably damaging Het
Ube4b A G 4: 149,443,622 (GRCm39) probably benign Het
Vmn1r125 A G 7: 21,006,308 (GRCm39) T69A probably damaging Het
Other mutations in Huwe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Huwe1 APN X 150,668,623 (GRCm39) missense probably damaging 1.00
IGL00707:Huwe1 APN X 150,643,730 (GRCm39) missense probably damaging 1.00
IGL00932:Huwe1 APN X 150,643,157 (GRCm39) splice site probably benign
IGL01413:Huwe1 APN X 150,665,676 (GRCm39) missense possibly damaging 0.48
IGL01685:Huwe1 APN X 150,681,666 (GRCm39) splice site probably benign
IGL02120:Huwe1 APN X 150,690,386 (GRCm39) missense possibly damaging 0.53
IGL02176:Huwe1 APN X 150,686,964 (GRCm39) missense possibly damaging 0.47
IGL02868:Huwe1 APN X 150,691,829 (GRCm39) missense possibly damaging 0.91
IGL02902:Huwe1 APN X 150,669,762 (GRCm39) missense probably damaging 0.98
IGL02971:Huwe1 APN X 150,710,622 (GRCm39) splice site probably benign
R0650:Huwe1 UTSW X 150,659,309 (GRCm39) missense probably damaging 1.00
R0651:Huwe1 UTSW X 150,659,309 (GRCm39) missense probably damaging 1.00
R0657:Huwe1 UTSW X 150,702,924 (GRCm39) missense probably benign 0.33
R1241:Huwe1 UTSW X 150,690,044 (GRCm39) small deletion probably benign
R1247:Huwe1 UTSW X 150,684,566 (GRCm39) missense probably benign 0.03
R1791:Huwe1 UTSW X 150,647,749 (GRCm39) missense probably benign 0.06
R4296:Huwe1 UTSW X 150,671,444 (GRCm39) missense probably benign 0.20
R4561:Huwe1 UTSW X 150,646,955 (GRCm39) missense probably damaging 1.00
R4562:Huwe1 UTSW X 150,646,955 (GRCm39) missense probably damaging 1.00
R5339:Huwe1 UTSW X 150,690,044 (GRCm39) small deletion probably benign
R8817:Huwe1 UTSW X 150,669,993 (GRCm39) missense probably benign 0.03
R8819:Huwe1 UTSW X 150,669,993 (GRCm39) missense probably benign 0.03
R9026:Huwe1 UTSW X 150,716,084 (GRCm39) missense unknown
R9027:Huwe1 UTSW X 150,716,084 (GRCm39) missense unknown
Z1176:Huwe1 UTSW X 150,711,377 (GRCm39) missense unknown
Z1176:Huwe1 UTSW X 150,639,571 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTGGTAGATAGTCACAAGAAG -3'
(R):5'- ACTGAAGCCCCTGCATATTTG -3'

Sequencing Primer
(F):5'- TGGTAGATAGTCACAAGAAGCAGTTC -3'
(R):5'- GAAGCCCCTGCATATTTGTTAATC -3'
Posted On 2015-09-24