Incidental Mutation 'R4564:Gpd2'
ID343224
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Nameglycerol phosphate dehydrogenase 2, mitochondrial
SynonymsGdm1
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location57237635-57370719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57307083 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 217 (V217I)
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028167
AA Change: V217I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: V217I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112618
AA Change: V217I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: V217I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148991
Predicted Effect possibly damaging
Transcript: ENSMUST00000169687
AA Change: V217I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: V217I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Meta Mutation Damage Score 0.0787 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57268084 critical splice donor site probably null
IGL01012:Gpd2 APN 2 57364530 missense probably benign 0.00
IGL01096:Gpd2 APN 2 57338867 missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57268071 nonsense probably null
IGL01816:Gpd2 APN 2 57364066 nonsense probably null
IGL02257:Gpd2 APN 2 57364524 missense probably benign 0.01
IGL02824:Gpd2 APN 2 57364327 missense probably null 0.89
IGL02832:Gpd2 APN 2 57338979 missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57355793 missense probably benign 0.06
IGL03107:Gpd2 APN 2 57355569 missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57338843 splice site probably benign
IGL03218:Gpd2 APN 2 57307054 missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57304486 critical splice donor site probably null
IGL03372:Gpd2 APN 2 57355507 missense probably damaging 1.00
kraft UTSW 2 57304396 missense probably damaging 0.96
R0012:Gpd2 UTSW 2 57338868 missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57338955 missense probably benign 0.16
R0379:Gpd2 UTSW 2 57345263 missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57340093 missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57355475 missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57357700 missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57357655 missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57355551 missense probably damaging 1.00
R2056:Gpd2 UTSW 2 57339013 critical splice donor site probably null
R2959:Gpd2 UTSW 2 57338975 nonsense probably null
R2960:Gpd2 UTSW 2 57338975 nonsense probably null
R2961:Gpd2 UTSW 2 57338975 nonsense probably null
R2962:Gpd2 UTSW 2 57338975 nonsense probably null
R3008:Gpd2 UTSW 2 57338975 nonsense probably null
R3009:Gpd2 UTSW 2 57338975 nonsense probably null
R3881:Gpd2 UTSW 2 57338975 nonsense probably null
R4073:Gpd2 UTSW 2 57290013 missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57355771 missense probably damaging 1.00
R4952:Gpd2 UTSW 2 57307013 nonsense probably null
R5030:Gpd2 UTSW 2 57304405 missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57355901 missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57340204 missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57364513 missense probably benign 0.18
R6325:Gpd2 UTSW 2 57304396 missense probably damaging 0.96
R6536:Gpd2 UTSW 2 57345355 missense probably benign 0.40
R6923:Gpd2 UTSW 2 57355788 missense probably damaging 0.98
R7058:Gpd2 UTSW 2 57307100 splice site probably null
R7380:Gpd2 UTSW 2 57340159 missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57306950 nonsense probably null
R8098:Gpd2 UTSW 2 57290008 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCCTTTCTTGTAATTTAAGGTGCC -3'
(R):5'- ATATGGTGACTCTCTACCTACGTG -3'

Sequencing Primer
(F):5'- GGTGCCAATCTATAGTGCTATACCG -3'
(R):5'- ACGTGAGTGCATTTGTTTGTTCC -3'
Posted On2015-09-24