Incidental Mutation 'R0058:Faf1'
ID 34323
Institutional Source Beutler Lab
Gene Symbol Faf1
Ensembl Gene ENSMUSG00000010517
Gene Name Fas-associated factor 1
Synonyms Dffrx, Fam
MMRRC Submission 038352-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0058 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 109676588-109963960 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109736624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 133 (Q133R)
Ref Sequence ENSEMBL: ENSMUSP00000099785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102724]
AlphaFold P54731
Predicted Effect probably benign
Transcript: ENSMUST00000102724
AA Change: Q133R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099785
Gene: ENSMUSG00000010517
AA Change: Q133R

DomainStartEndE-ValueType
Pfam:UBA_4 8 43 2.5e-10 PFAM
low complexity region 68 82 N/A INTRINSIC
internal_repeat_1 109 155 3.24e-5 PROSPERO
low complexity region 174 180 N/A INTRINSIC
internal_repeat_1 204 250 3.24e-5 PROSPERO
UAS 335 480 3.79e-69 SMART
coiled coil region 496 560 N/A INTRINSIC
UBX 565 647 2.32e-33 SMART
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous fail to develop beyond 2-cell stage. Mice homozygous for a hypomorphic gene trap allele exhibit decreased susceptibility to dopaminergic neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Bpifb1 G A 2: 154,206,540 R165H possibly damaging Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Golga3 T A 5: 110,202,777 F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Olfr323 A T 11: 58,625,668 I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Prrc2c C T 1: 162,698,884 V253I unknown Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stam T C 2: 14,138,141 C336R probably damaging Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Tspear T C 10: 77,869,631 F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Faf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Faf1 APN 4 109840381 missense probably benign 0.10
IGL00569:Faf1 APN 4 109961880 makesense probably null
IGL01398:Faf1 APN 4 109736596 missense probably damaging 0.99
IGL01640:Faf1 APN 4 109840403 missense probably damaging 1.00
IGL01739:Faf1 APN 4 109677081 splice site probably benign
IGL02265:Faf1 APN 4 109742904 missense probably benign 0.00
IGL02372:Faf1 APN 4 109935582 missense probably benign 0.17
IGL02999:Faf1 APN 4 109861893 missense probably benign 0.01
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0183:Faf1 UTSW 4 109935610 missense probably benign
R0463:Faf1 UTSW 4 109890941 missense probably benign 0.02
R0505:Faf1 UTSW 4 109840403 missense possibly damaging 0.91
R0755:Faf1 UTSW 4 109961839 missense probably benign 0.00
R1705:Faf1 UTSW 4 109677002 start gained probably benign
R2061:Faf1 UTSW 4 109710808 missense probably damaging 1.00
R2132:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2133:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2696:Faf1 UTSW 4 109841328 missense possibly damaging 0.92
R3937:Faf1 UTSW 4 109757692 splice site probably benign
R3939:Faf1 UTSW 4 109861879 missense probably damaging 1.00
R4602:Faf1 UTSW 4 109727428 missense probably benign
R4727:Faf1 UTSW 4 109840367 missense probably damaging 0.96
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4896:Faf1 UTSW 4 109842299 missense probably benign 0.02
R4913:Faf1 UTSW 4 109935549 missense possibly damaging 0.96
R5688:Faf1 UTSW 4 109794813 missense probably damaging 1.00
R5721:Faf1 UTSW 4 109935666 missense probably benign 0.34
R5905:Faf1 UTSW 4 109890929 missense probably benign 0.03
R6190:Faf1 UTSW 4 109861815 missense probably damaging 0.97
R6364:Faf1 UTSW 4 109961800 missense possibly damaging 0.46
R6454:Faf1 UTSW 4 109842334 missense probably benign 0.27
R6805:Faf1 UTSW 4 109861852 missense probably damaging 1.00
R7101:Faf1 UTSW 4 109925956 missense probably benign 0.12
R7381:Faf1 UTSW 4 109861937 missense probably damaging 0.99
R7392:Faf1 UTSW 4 109794843 missense probably benign 0.01
R7584:Faf1 UTSW 4 109925957 missense probably damaging 0.99
R7660:Faf1 UTSW 4 109861837 missense probably damaging 0.98
R7678:Faf1 UTSW 4 109829864 missense probably benign 0.00
R7715:Faf1 UTSW 4 109710814 missense probably damaging 0.99
R7721:Faf1 UTSW 4 109736597 missense probably damaging 1.00
R8773:Faf1 UTSW 4 109842310 missense possibly damaging 0.81
R9004:Faf1 UTSW 4 109841353 missense probably benign 0.01
R9028:Faf1 UTSW 4 109890908 missense possibly damaging 0.54
R9646:Faf1 UTSW 4 109794819 missense probably damaging 1.00
R9700:Faf1 UTSW 4 109890982 missense possibly damaging 0.48
Z1176:Faf1 UTSW 4 109840356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATTATTCAGGCAGCAGGGTTTACAG -3'
(R):5'- CAGTGTATGTGACTtctttcaggcca -3'

Sequencing Primer
(F):5'- AATCCGCCTTGGCTTATATCAGAG -3'
(R):5'- tggggcagagggaataaaag -3'
Posted On 2013-05-09