Incidental Mutation 'R4564:Lrrc71'
ID343230
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Nameleucine rich repeat containing 71
Synonyms
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87736923-87748625 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 87745408 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172621] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079083
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172621
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174759
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87745224 unclassified probably null
IGL02387:Lrrc71 APN 3 87743071 missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87743340 missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87741772 missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87745777 missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87745699 missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87742645 synonymous probably null
R1511:Lrrc71 UTSW 3 87745484 missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87741841 missense possibly damaging 0.87
R1987:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R2054:Lrrc71 UTSW 3 87742673 missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87745521 nonsense probably null
R2427:Lrrc71 UTSW 3 87746002 missense probably benign
R3700:Lrrc71 UTSW 3 87745878 splice site probably null
R4073:Lrrc71 UTSW 3 87745262 missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87740991 missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87742836 missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87742665 missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4563:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4724:Lrrc71 UTSW 3 87739174 missense probably damaging 0.97
R4826:Lrrc71 UTSW 3 87743308 missense probably benign 0.33
R5156:Lrrc71 UTSW 3 87745787 missense probably benign 0.07
R5631:Lrrc71 UTSW 3 87739149 missense probably benign 0.00
R6182:Lrrc71 UTSW 3 87745794 missense probably benign 0.41
R6558:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R6885:Lrrc71 UTSW 3 87742620 splice site probably null
R7036:Lrrc71 UTSW 3 87748386 missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87743077 missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87743326 missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87742974 missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87741806 missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87739462 missense probably damaging 1.00
Z1177:Lrrc71 UTSW 3 87742821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACAACTGACCTGAGTGTG -3'
(R):5'- ACTCATTACGCCAGCGCATC -3'

Sequencing Primer
(F):5'- CTGACCTGAGTGTGGAGGAAC -3'
(R):5'- TCACGGGCTCACAATTCATG -3'
Posted On2015-09-24