Incidental Mutation 'R4557:Nalcn'
ID343245
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 123321235 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201] [ENSMUST00000000201] [ENSMUST00000000201]
Predicted Effect probably benign
Transcript: ENSMUST00000000201
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000000201
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000000201
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttc27 T G 17: 74,829,549 S584A probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
R7361:Nalcn UTSW 14 123291839 missense probably benign 0.00
R7378:Nalcn UTSW 14 123302890 missense probably damaging 1.00
R7408:Nalcn UTSW 14 123291860 missense probably benign 0.00
R7470:Nalcn UTSW 14 123572044 missense probably benign 0.09
R7483:Nalcn UTSW 14 123314087 missense probably damaging 1.00
R7521:Nalcn UTSW 14 123293458 missense probably damaging 1.00
R7558:Nalcn UTSW 14 123486385 critical splice donor site probably null
R7585:Nalcn UTSW 14 123515638 missense probably damaging 1.00
R7591:Nalcn UTSW 14 123323885 missense probably benign 0.01
R7761:Nalcn UTSW 14 123294379 missense probably damaging 1.00
R7761:Nalcn UTSW 14 123294380 missense probably damaging 1.00
R7811:Nalcn UTSW 14 123298945 missense probably damaging 1.00
R7983:Nalcn UTSW 14 123592997 missense probably benign 0.17
R8089:Nalcn UTSW 14 123299960 missense probably damaging 1.00
R8110:Nalcn UTSW 14 123464701 missense probably benign 0.00
R8190:Nalcn UTSW 14 123599939 missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123317024 missense probably damaging 1.00
R8407:Nalcn UTSW 14 123317271 missense probably damaging 1.00
R8497:Nalcn UTSW 14 123515359 missense probably damaging 1.00
R8544:Nalcn UTSW 14 123371523 missense probably benign 0.40
R8549:Nalcn UTSW 14 123370036 missense probably benign 0.01
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123294445 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123594568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGTTACCTGCTTGAAAC -3'
(R):5'- AAAAGGTACTGGTTGTGTCCTG -3'

Sequencing Primer
(F):5'- GAAACCTTTATTTTCCACCTGGTCAG -3'
(R):5'- CCTGAGGTTCTCATTTAAGACTGGC -3'
Posted On2015-09-24