Mutagenetix > Incidental Mutations

Incidental Mutation 'R4568:Slc5a9'

343251

Institutional Source

Beutler Lab

Gene Symbol

Slc5a9

Ensembl Gene

ENSMUSG00000028544

Gene Name

solute carrier family 5 (sodium/glucose cotransporter), member 9

Synonyms

SGLT4

MMRRC Submission

041792-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R4568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111875375-111902918 bp(-) (GRCm38)

Type of Mutation

splice site (43 bp from exon)

DNA Base Change (assembly)

C to A at 111891744 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]

Predicted Effect

probably null
Transcript: ENSMUST00000102719

SMART Domains

Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544

Domain	Start	End	E-Value	Type
low complexity region	34	44	N/A	INTRINSIC
Pfam:SSF	63	492	2.3e-152	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
transmembrane domain	665	684	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102720

SMART Domains

Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544

Domain	Start	End	E-Value	Type
low complexity region	34	44	N/A	INTRINSIC
Pfam:SSF	63	492	2.3e-152	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
transmembrane domain	665	684	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102721

SMART Domains

Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544

Domain	Start	End	E-Value	Type
low complexity region	34	44	N/A	INTRINSIC
Pfam:SSF	63	492	2.3e-152	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
transmembrane domain	665	684	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000128340

SMART Domains

Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544

Domain	Start	End	E-Value	Type
Pfam:SSF	23	255	9.3e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149922

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (36/36)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,563,517	W5R	probably benign	Het
Bik	T	C	15: 83,541,444		probably null	Het
Col6a1	A	T	10: 76,719,197		probably benign	Het
Crem	A	G	18: 3,299,175	I83T	probably damaging	Het
Csn1s1	G	A	5: 87,680,904	V276I	possibly damaging	Het
Ctnna3	C	T	10: 63,852,809	T344M	possibly damaging	Het
Dgcr8	G	A	16: 18,280,394	P378S	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fam208a	A	T	14: 27,476,701		probably null	Het
Gpr139	C	T	7: 119,144,805	V186M	probably damaging	Het
Krba1	A	G	6: 48,409,723	T422A	probably damaging	Het
Lgals8	T	G	13: 12,453,373	Y125S	probably damaging	Het
Map4k1	G	A	7: 28,986,654	G107D	probably damaging	Het
Mfsd6	A	T	1: 52,663,289	Y599*	probably null	Het
Olfr1411	A	T	1: 92,597,391	M291L	probably benign	Het
Olfr412	A	G	11: 74,365,209	E180G	probably damaging	Het
Omt2b	T	A	9: 78,328,247		probably benign	Het
Pga5	A	G	19: 10,671,852	Y235H	probably damaging	Het
Phldb2	T	A	16: 45,777,718	K869*	probably null	Het
Pik3cb	T	C	9: 99,090,302	M268V	probably benign	Het
Pla2g4a	T	C	1: 149,842,226	D624G	probably benign	Het
Plxna4	T	A	6: 32,152,938	I1817F	probably damaging	Het
Psmg3	A	G	5: 139,826,249	I32T	probably damaging	Het
Ptpn4	T	C	1: 119,680,059	E757G	probably damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Ripply3	T	A	16: 94,335,829	D116E	probably damaging	Het
Robo4	T	C	9: 37,404,822	V263A	possibly damaging	Het
Spef2	T	C	15: 9,647,217	H1008R	probably damaging	Het
Stag1	T	C	9: 100,848,669	V379A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,177	E1121G	probably benign	Het
Tpr	T	C	1: 150,392,959		probably benign	Het
Trpv6	G	T	6: 41,626,569	P206H	probably damaging	Het
Vmn2r63	T	C	7: 42,933,826		probably null	Het
Vmn2r65	C	T	7: 84,947,469	C126Y	probably damaging	Het

Other mutations in Slc5a9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Slc5a9	APN	4	111898569	missense	probably damaging	0.99
IGL00837:Slc5a9	APN	4	111893690	intron	probably benign
IGL01556:Slc5a9	APN	4	111898636	missense	probably benign	0.00
IGL01807:Slc5a9	APN	4	111877540	makesense	probably null
IGL01816:Slc5a9	APN	4	111898614	missense	probably damaging	1.00
IGL02066:Slc5a9	APN	4	111887522	missense	probably damaging	1.00
IGL02370:Slc5a9	APN	4	111877629	missense	probably benign	0.01
IGL02491:Slc5a9	APN	4	111896352	missense	probably damaging	0.99
IGL02971:Slc5a9	APN	4	111890300	missense	possibly damaging	0.58
IGL03008:Slc5a9	APN	4	111890941	missense	probably benign	0.14
R0365:Slc5a9	UTSW	4	111891836	nonsense	probably null
R0559:Slc5a9	UTSW	4	111885582	missense	probably benign	0.02
R0659:Slc5a9	UTSW	4	111883871	missense	possibly damaging	0.82
R1454:Slc5a9	UTSW	4	111883964	missense	probably benign	0.04
R2006:Slc5a9	UTSW	4	111880226	missense	probably benign
R2014:Slc5a9	UTSW	4	111896349	missense	possibly damaging	0.76
R2024:Slc5a9	UTSW	4	111890531	missense	probably damaging	1.00
R2076:Slc5a9	UTSW	4	111885573	missense	possibly damaging	0.76
R2152:Slc5a9	UTSW	4	111893223	missense	possibly damaging	0.76
R3156:Slc5a9	UTSW	4	111890224	missense	possibly damaging	0.80
R4566:Slc5a9	UTSW	4	111891744	splice site	probably null
R4579:Slc5a9	UTSW	4	111893187	missense	probably damaging	1.00
R4656:Slc5a9	UTSW	4	111891744	splice site	probably null
R4657:Slc5a9	UTSW	4	111891744	splice site	probably null
R4700:Slc5a9	UTSW	4	111890937	missense	possibly damaging	0.64
R4889:Slc5a9	UTSW	4	111891744	splice site	probably null
R4891:Slc5a9	UTSW	4	111891744	splice site	probably null
R4911:Slc5a9	UTSW	4	111891744	splice site	probably null
R4948:Slc5a9	UTSW	4	111891744	splice site	probably null
R4953:Slc5a9	UTSW	4	111891744	splice site	probably null
R5222:Slc5a9	UTSW	4	111898611	missense	possibly damaging	0.55
R5376:Slc5a9	UTSW	4	111893217	missense	possibly damaging	0.80
R5502:Slc5a9	UTSW	4	111893169	nonsense	probably null
R5851:Slc5a9	UTSW	4	111885600	missense	probably benign
R6030:Slc5a9	UTSW	4	111885528	missense	possibly damaging	0.64
R6030:Slc5a9	UTSW	4	111885528	missense	possibly damaging	0.64
R6125:Slc5a9	UTSW	4	111883805	missense	probably damaging	1.00
R6326:Slc5a9	UTSW	4	111880253	missense	probably benign
R6438:Slc5a9	UTSW	4	111891825	missense	probably benign	0.00
R7105:Slc5a9	UTSW	4	111898695	missense	probably benign
R7166:Slc5a9	UTSW	4	111883839	missense	probably benign	0.04
R7489:Slc5a9	UTSW	4	111883916	missense	probably damaging	1.00
R7599:Slc5a9	UTSW	4	111877740	missense	probably benign
R7662:Slc5a9	UTSW	4	111877540	makesense	probably null
R7762:Slc5a9	UTSW	4	111890174	missense	probably damaging	0.99
R7992:Slc5a9	UTSW	4	111890532	missense	probably benign	0.37
X0012:Slc5a9	UTSW	4	111893314	missense	probably damaging	0.99
Z1177:Slc5a9	UTSW	4	111891816	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGTACAACTCATCCTCAGCAGG -3'
(R):5'- GGGTGCTGACTTTCTACAGAC -3'

Sequencing Primer
(F):5'- AGCAGGACCCCATGTCTCTC -3'
(R):5'- ACAGACTGATATCTTCTCTGGAGC -3'

Posted On

2015-09-24