Incidental Mutation 'R4568:Slc5a9'
ID343251
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 9
SynonymsSGLT4
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location111875375-111902918 bp(-) (GRCm38)
Type of Mutationintron (43 bp from exon)
DNA Base Change (assembly) C to A at 111891744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]
Predicted Effect probably null
Transcript: ENSMUST00000102719
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102720
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102721
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128340
SMART Domains Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
Pfam:SSF 23 255 9.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149922
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111898569 missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111893690 intron probably benign
IGL01556:Slc5a9 APN 4 111898636 missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111877540 makesense probably null
IGL01816:Slc5a9 APN 4 111898614 missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111887522 missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111877629 missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111896352 missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111890300 missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111890941 missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111891836 nonsense probably null
R0559:Slc5a9 UTSW 4 111885582 missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111883871 missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111883964 missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111880226 missense probably benign
R2014:Slc5a9 UTSW 4 111896349 missense possibly damaging 0.76
R2024:Slc5a9 UTSW 4 111890531 missense probably damaging 1.00
R2076:Slc5a9 UTSW 4 111885573 missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111893223 missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111890224 missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111891744 intron probably null
R4579:Slc5a9 UTSW 4 111893187 missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111891744 intron probably null
R4657:Slc5a9 UTSW 4 111891744 intron probably null
R4700:Slc5a9 UTSW 4 111890937 missense possibly damaging 0.64
R4889:Slc5a9 UTSW 4 111891744 intron probably null
R4891:Slc5a9 UTSW 4 111891744 intron probably null
R4911:Slc5a9 UTSW 4 111891744 intron probably null
R4948:Slc5a9 UTSW 4 111891744 intron probably null
R4953:Slc5a9 UTSW 4 111891744 intron probably null
R5222:Slc5a9 UTSW 4 111898611 missense possibly damaging 0.55
R5376:Slc5a9 UTSW 4 111893217 missense possibly damaging 0.80
R5502:Slc5a9 UTSW 4 111893169 nonsense probably null
R5851:Slc5a9 UTSW 4 111885600 missense probably benign
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111883805 missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111880253 missense probably benign
R6438:Slc5a9 UTSW 4 111891825 missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111898695 missense probably benign
R7166:Slc5a9 UTSW 4 111883839 missense probably benign 0.04
R7489:Slc5a9 UTSW 4 111883916 missense probably damaging 1.00
R7599:Slc5a9 UTSW 4 111877740 missense probably benign
R7662:Slc5a9 UTSW 4 111877540 makesense probably null
R7762:Slc5a9 UTSW 4 111890174 missense probably damaging 0.99
X0012:Slc5a9 UTSW 4 111893314 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACAACTCATCCTCAGCAGG -3'
(R):5'- GGGTGCTGACTTTCTACAGAC -3'

Sequencing Primer
(F):5'- AGCAGGACCCCATGTCTCTC -3'
(R):5'- ACAGACTGATATCTTCTCTGGAGC -3'
Posted On2015-09-24