Incidental Mutation 'R4564:Zfp346'
ID343256
Institutional Source Beutler Lab
Gene Symbol Zfp346
Ensembl Gene ENSMUSG00000021481
Gene Namezinc finger protein 346
Synonyms
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55105311-55134825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55113707 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 103 (R103S)
Ref Sequence ENSEMBL: ENSMUSP00000021937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021937] [ENSMUST00000159147] [ENSMUST00000159278] [ENSMUST00000160660] [ENSMUST00000161315] [ENSMUST00000161551] [ENSMUST00000162428] [ENSMUST00000162476]
Predicted Effect probably damaging
Transcript: ENSMUST00000021937
AA Change: R103S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021937
Gene: ENSMUSG00000021481
AA Change: R103S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 182 216 1.87e-8 SMART
ZnF_C2H2 185 209 1.51e1 SMART
ZnF_U1 236 270 1.99e-3 SMART
ZnF_C2H2 239 263 3.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159147
SMART Domains Protein: ENSMUSP00000124107
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:zf-met 73 96 3.3e-5 PFAM
ZnF_U1 99 133 5.22e-7 SMART
ZnF_C2H2 102 126 4.98e-1 SMART
ZnF_U1 150 184 1.87e-8 SMART
ZnF_C2H2 153 177 1.51e1 SMART
ZnF_U1 204 238 1.99e-3 SMART
ZnF_C2H2 207 231 3.47e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159278
AA Change: R103S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125078
Gene: ENSMUSG00000021481
AA Change: R103S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 198 232 1.87e-8 SMART
ZnF_C2H2 201 225 1.51e1 SMART
ZnF_U1 251 285 1.99e-3 SMART
ZnF_C2H2 254 278 3.47e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160660
AA Change: R103S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124034
Gene: ENSMUSG00000021481
AA Change: R103S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161018
SMART Domains Protein: ENSMUSP00000125154
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161077
AA Change: R84S
SMART Domains Protein: ENSMUSP00000125204
Gene: ENSMUSG00000021481
AA Change: R84S

DomainStartEndE-ValueType
ZnF_U1 52 86 1.26e-5 SMART
ZnF_C2H2 55 79 2.61e1 SMART
ZnF_U1 113 147 5.22e-7 SMART
ZnF_C2H2 116 140 4.98e-1 SMART
ZnF_U1 180 214 1.87e-8 SMART
ZnF_C2H2 183 207 1.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161315
AA Change: R103S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124397
Gene: ENSMUSG00000021481
AA Change: R103S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161551
SMART Domains Protein: ENSMUSP00000124180
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
PDB:1ZU1|A 53 93 4e-12 PDB
Blast:ZnF_U1 70 94 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162288
Predicted Effect probably damaging
Transcript: ENSMUST00000162428
AA Change: R103S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125389
Gene: ENSMUSG00000021481
AA Change: R103S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162476
AA Change: R103S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125743
Gene: ENSMUSG00000021481
AA Change: R103S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Meta Mutation Damage Score 0.1681 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar, zinc finger protein that preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids, rather than DNA alone. Mutational studies indicate that the zinc finger domains are not only essential for dsRNA binding, but are also required for its nucleolar localization. The encoded protein may be involved in cell growth and survival. It plays a role in protecting neurons by inhibiting cell cycle re-entry via stimulation of p21 gene expression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Other mutations in Zfp346
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Zfp346 UTSW 13 55113097 nonsense probably null
R2025:Zfp346 UTSW 13 55132308 missense probably damaging 1.00
R2879:Zfp346 UTSW 13 55105350 missense possibly damaging 0.66
R4821:Zfp346 UTSW 13 55113813 intron probably benign
R5647:Zfp346 UTSW 13 55122357 missense probably damaging 1.00
R5665:Zfp346 UTSW 13 55113102 missense probably benign 0.39
R6145:Zfp346 UTSW 13 55115574 missense probably damaging 0.98
R6450:Zfp346 UTSW 13 55113704 missense probably damaging 1.00
R7034:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7036:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7148:Zfp346 UTSW 13 55105450 missense possibly damaging 0.78
R7298:Zfp346 UTSW 13 55130603 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACAGTATCGTTGTATGCAGATCTT -3'
(R):5'- CGGATTTTGAGTCTGGCACTG -3'

Sequencing Primer
(F):5'- ATCTTGCCGGACAACGTGATG -3'
(R):5'- ACAGTCTGTCATGTAGCCCAG -3'
Posted On2015-09-24