Incidental Mutation 'R4564:Dip2b'
ID 343259
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 041789-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R4564 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 100055139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 99 (W99*)
Ref Sequence ENSEMBL: ENSMUSP00000104599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably null
Transcript: ENSMUST00000023768
AA Change: W99*
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: W99*

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100203
AA Change: W333*
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: W333*

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108971
AA Change: W99*
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: W99*

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,831,766 (GRCm39) probably null Het
Bach2 T G 4: 32,563,338 (GRCm39) S602A probably damaging Het
Ccl19 G T 4: 42,756,295 (GRCm39) S12R probably damaging Het
Cfap54 T C 10: 92,675,402 (GRCm39) probably benign Het
Cndp1 T A 18: 84,640,411 (GRCm39) I265F probably damaging Het
Cnot3 G A 7: 3,656,257 (GRCm39) R181H probably damaging Het
Dicer1 T A 12: 104,671,010 (GRCm39) K1011* probably null Het
Fpr-rs6 A T 17: 20,403,168 (GRCm39) Y64* probably null Het
Fubp1 C A 3: 151,928,573 (GRCm39) Y480* probably null Het
Gfra1 T C 19: 58,227,682 (GRCm39) probably null Het
Gm10770 T C 2: 150,020,831 (GRCm39) T229A probably benign Het
Gm826 A C 2: 160,153,913 (GRCm39) probably benign Het
Gpd2 G A 2: 57,197,095 (GRCm39) V217I possibly damaging Het
Hectd4 T C 5: 121,488,494 (GRCm39) I3595T probably benign Het
Lmln A G 16: 32,930,226 (GRCm39) E561G probably benign Het
Lrrc71 T A 3: 87,652,715 (GRCm39) probably benign Het
Man2a2 T A 7: 80,018,586 (GRCm39) Y91F probably benign Het
Map4k4 A G 1: 40,028,135 (GRCm39) T319A probably damaging Het
Mcm6 G T 1: 128,271,196 (GRCm39) H474Q probably damaging Het
Mn1 C G 5: 111,568,533 (GRCm39) N834K possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Niban3 T C 8: 72,057,704 (GRCm39) probably benign Het
Npas2 A G 1: 39,326,647 (GRCm39) D44G probably damaging Het
Npc1 C T 18: 12,324,789 (GRCm39) G1235R probably damaging Het
Olfml2a C T 2: 38,850,306 (GRCm39) T674I probably benign Het
Or4f58 A G 2: 111,852,112 (GRCm39) L29P possibly damaging Het
Pgap6 A G 17: 26,336,837 (GRCm39) R252G possibly damaging Het
Plxnb1 C T 9: 108,942,488 (GRCm39) A1779V probably benign Het
Ppil3 T A 1: 58,470,481 (GRCm39) D123V probably damaging Het
Prr23a3 A G 9: 98,747,190 (GRCm39) E48G probably damaging Het
Prr5l T C 2: 101,577,094 (GRCm39) E110G probably damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
R3hdm1 C T 1: 128,149,396 (GRCm39) T839M probably benign Het
Rasgrf2 G A 13: 92,033,773 (GRCm39) Q544* probably null Het
Riok3 C A 18: 12,281,936 (GRCm39) R302S probably damaging Het
Rnf145 A G 11: 44,439,635 (GRCm39) K144E probably benign Het
Sin3b A C 8: 73,480,209 (GRCm39) T904P probably damaging Het
Skint4 C T 4: 111,977,066 (GRCm39) T152M probably damaging Het
Slc22a2 A G 17: 12,828,943 (GRCm39) I350V probably benign Het
Slc6a11 G T 6: 114,108,323 (GRCm39) G29V probably benign Het
Speg A C 1: 75,368,478 (GRCm39) H676P probably damaging Het
St6gal2 T A 17: 55,789,648 (GRCm39) H227Q probably damaging Het
Strn3 A G 12: 51,680,404 (GRCm39) S399P probably benign Het
Tbc1d1 A G 5: 64,330,827 (GRCm39) E2G probably damaging Het
Tecpr2 T A 12: 110,921,219 (GRCm39) M1264K probably benign Het
Trpm6 T C 19: 18,809,961 (GRCm39) L1119P possibly damaging Het
Upf2 A C 2: 6,032,123 (GRCm39) T890P unknown Het
Upk1b T A 16: 38,600,469 (GRCm39) K170N probably benign Het
Vmn1r78 A T 7: 11,886,485 (GRCm39) Y32F probably damaging Het
Vps11 A G 9: 44,272,894 (GRCm39) F12S probably damaging Het
Zfp318 T A 17: 46,723,741 (GRCm39) C1915S possibly damaging Het
Zfp346 A C 13: 55,261,520 (GRCm39) R103S probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCCTAGTTGTCCTGTC -3'
(R):5'- AACTGAGCCATTTGCAACTGAG -3'

Sequencing Primer
(F):5'- CCTAGTTGTCCTGTCTCAATGTGAG -3'
(R):5'- GAGCCATTTGCAACTGAGAAATAAC -3'
Posted On 2015-09-24