Incidental Mutation 'R4564:Lmln'
ID 343260
Institutional Source Beutler Lab
Gene Symbol Lmln
Ensembl Gene ENSMUSG00000022802
Gene Name leishmanolysin-like (metallopeptidase M8 family)
Synonyms 5330415H22Rik
MMRRC Submission 041789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R4564 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 32882891-32948065 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32930226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 561 (E561G)
Ref Sequence ENSEMBL: ENSMUSP00000023497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023497]
AlphaFold Q8BMN4
Predicted Effect probably benign
Transcript: ENSMUST00000023497
AA Change: E561G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802
AA Change: E561G

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158235
Meta Mutation Damage Score 0.4919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,831,766 (GRCm39) probably null Het
Bach2 T G 4: 32,563,338 (GRCm39) S602A probably damaging Het
Ccl19 G T 4: 42,756,295 (GRCm39) S12R probably damaging Het
Cfap54 T C 10: 92,675,402 (GRCm39) probably benign Het
Cndp1 T A 18: 84,640,411 (GRCm39) I265F probably damaging Het
Cnot3 G A 7: 3,656,257 (GRCm39) R181H probably damaging Het
Dicer1 T A 12: 104,671,010 (GRCm39) K1011* probably null Het
Dip2b G A 15: 100,055,139 (GRCm39) W99* probably null Het
Fpr-rs6 A T 17: 20,403,168 (GRCm39) Y64* probably null Het
Fubp1 C A 3: 151,928,573 (GRCm39) Y480* probably null Het
Gfra1 T C 19: 58,227,682 (GRCm39) probably null Het
Gm10770 T C 2: 150,020,831 (GRCm39) T229A probably benign Het
Gm826 A C 2: 160,153,913 (GRCm39) probably benign Het
Gpd2 G A 2: 57,197,095 (GRCm39) V217I possibly damaging Het
Hectd4 T C 5: 121,488,494 (GRCm39) I3595T probably benign Het
Lrrc71 T A 3: 87,652,715 (GRCm39) probably benign Het
Man2a2 T A 7: 80,018,586 (GRCm39) Y91F probably benign Het
Map4k4 A G 1: 40,028,135 (GRCm39) T319A probably damaging Het
Mcm6 G T 1: 128,271,196 (GRCm39) H474Q probably damaging Het
Mn1 C G 5: 111,568,533 (GRCm39) N834K possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Niban3 T C 8: 72,057,704 (GRCm39) probably benign Het
Npas2 A G 1: 39,326,647 (GRCm39) D44G probably damaging Het
Npc1 C T 18: 12,324,789 (GRCm39) G1235R probably damaging Het
Olfml2a C T 2: 38,850,306 (GRCm39) T674I probably benign Het
Or4f58 A G 2: 111,852,112 (GRCm39) L29P possibly damaging Het
Pgap6 A G 17: 26,336,837 (GRCm39) R252G possibly damaging Het
Plxnb1 C T 9: 108,942,488 (GRCm39) A1779V probably benign Het
Ppil3 T A 1: 58,470,481 (GRCm39) D123V probably damaging Het
Prr23a3 A G 9: 98,747,190 (GRCm39) E48G probably damaging Het
Prr5l T C 2: 101,577,094 (GRCm39) E110G probably damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
R3hdm1 C T 1: 128,149,396 (GRCm39) T839M probably benign Het
Rasgrf2 G A 13: 92,033,773 (GRCm39) Q544* probably null Het
Riok3 C A 18: 12,281,936 (GRCm39) R302S probably damaging Het
Rnf145 A G 11: 44,439,635 (GRCm39) K144E probably benign Het
Sin3b A C 8: 73,480,209 (GRCm39) T904P probably damaging Het
Skint4 C T 4: 111,977,066 (GRCm39) T152M probably damaging Het
Slc22a2 A G 17: 12,828,943 (GRCm39) I350V probably benign Het
Slc6a11 G T 6: 114,108,323 (GRCm39) G29V probably benign Het
Speg A C 1: 75,368,478 (GRCm39) H676P probably damaging Het
St6gal2 T A 17: 55,789,648 (GRCm39) H227Q probably damaging Het
Strn3 A G 12: 51,680,404 (GRCm39) S399P probably benign Het
Tbc1d1 A G 5: 64,330,827 (GRCm39) E2G probably damaging Het
Tecpr2 T A 12: 110,921,219 (GRCm39) M1264K probably benign Het
Trpm6 T C 19: 18,809,961 (GRCm39) L1119P possibly damaging Het
Upf2 A C 2: 6,032,123 (GRCm39) T890P unknown Het
Upk1b T A 16: 38,600,469 (GRCm39) K170N probably benign Het
Vmn1r78 A T 7: 11,886,485 (GRCm39) Y32F probably damaging Het
Vps11 A G 9: 44,272,894 (GRCm39) F12S probably damaging Het
Zfp318 T A 17: 46,723,741 (GRCm39) C1915S possibly damaging Het
Zfp346 A C 13: 55,261,520 (GRCm39) R103S probably damaging Het
Other mutations in Lmln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Lmln APN 16 32,903,435 (GRCm39) missense probably benign 0.08
IGL01346:Lmln APN 16 32,937,490 (GRCm39) missense probably benign 0.00
IGL01664:Lmln APN 16 32,901,357 (GRCm39) missense probably benign 0.03
nemeth UTSW 16 32,894,467 (GRCm39) nonsense probably null
R0234:Lmln UTSW 16 32,886,694 (GRCm39) missense probably damaging 0.99
R0234:Lmln UTSW 16 32,886,694 (GRCm39) missense probably damaging 0.99
R0562:Lmln UTSW 16 32,937,455 (GRCm39) nonsense probably null
R1017:Lmln UTSW 16 32,908,546 (GRCm39) missense probably benign
R1557:Lmln UTSW 16 32,908,581 (GRCm39) missense probably benign 0.25
R1617:Lmln UTSW 16 32,937,500 (GRCm39) missense probably damaging 1.00
R2211:Lmln UTSW 16 32,930,148 (GRCm39) missense probably benign 0.00
R4061:Lmln UTSW 16 32,886,761 (GRCm39) nonsense probably null
R4414:Lmln UTSW 16 32,930,220 (GRCm39) missense probably benign 0.00
R4512:Lmln UTSW 16 32,908,507 (GRCm39) missense probably benign 0.01
R4995:Lmln UTSW 16 32,894,467 (GRCm39) nonsense probably null
R5044:Lmln UTSW 16 32,894,550 (GRCm39) missense possibly damaging 0.80
R6109:Lmln UTSW 16 32,889,481 (GRCm39) missense possibly damaging 0.69
R6287:Lmln UTSW 16 32,894,555 (GRCm39) critical splice donor site probably null
R6577:Lmln UTSW 16 32,927,370 (GRCm39) splice site probably null
R6689:Lmln UTSW 16 32,925,152 (GRCm39) missense probably benign 0.19
R7079:Lmln UTSW 16 32,887,661 (GRCm39) missense probably benign 0.02
R7432:Lmln UTSW 16 32,909,738 (GRCm39) missense probably damaging 1.00
R7807:Lmln UTSW 16 32,927,501 (GRCm39) missense probably benign 0.04
R8185:Lmln UTSW 16 32,909,690 (GRCm39) missense probably damaging 1.00
R8942:Lmln UTSW 16 32,901,330 (GRCm39) missense probably damaging 0.99
R9123:Lmln UTSW 16 32,930,202 (GRCm39) missense probably benign 0.01
R9365:Lmln UTSW 16 32,925,169 (GRCm39) nonsense probably null
R9491:Lmln UTSW 16 32,890,358 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCAGAACAACGTTTAGTCAC -3'
(R):5'- CCAACAGTTAAAAGCAATGTCAGAG -3'

Sequencing Primer
(F):5'- CGTTTAGTCACGAGAAGATTGCCTC -3'
(R):5'- TGACAGTATTTTCACAAACCGCAG -3'
Posted On 2015-09-24