Incidental Mutation 'R4564:Zfp318'
ID343266
Institutional Source Beutler Lab
Gene Symbol Zfp318
Ensembl Gene ENSMUSG00000015597
Gene Namezinc finger protein 318
Synonyms2610034E08Rik, D530032D06Rik, TZF
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46383731-46420920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46412815 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1915 (C1915S)
Ref Sequence ENSEMBL: ENSMUSP00000109109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113481
AA Change: C1915S

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597
AA Change: C1915S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136017
Predicted Effect probably benign
Transcript: ENSMUST00000138127
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152472
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Zfp318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
Wonton UTSW 17 46409692 missense possibly damaging 0.89
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1327:Zfp318 UTSW 17 46413263 missense probably damaging 1.00
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1800:Zfp318 UTSW 17 46412054 missense probably benign 0.00
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 intron probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5643:Zfp318 UTSW 17 46409244 intron probably benign
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6812:Zfp318 UTSW 17 46412542 unclassified probably benign
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6980:Zfp318 UTSW 17 46397212 missense probably damaging 1.00
R6999:Zfp318 UTSW 17 46400043 missense probably damaging 1.00
R7164:Zfp318 UTSW 17 46397306 critical splice donor site probably null
R7164:Zfp318 UTSW 17 46405939 missense probably damaging 1.00
R7175:Zfp318 UTSW 17 46386848 missense probably damaging 1.00
R7233:Zfp318 UTSW 17 46406052 missense probably damaging 0.99
R7339:Zfp318 UTSW 17 46411247 missense probably damaging 0.99
R7426:Zfp318 UTSW 17 46400069 missense probably damaging 1.00
R7600:Zfp318 UTSW 17 46384284 missense possibly damaging 0.86
R7608:Zfp318 UTSW 17 46400009 missense probably damaging 0.96
R7779:Zfp318 UTSW 17 46399894 missense probably benign 0.16
R8057:Zfp318 UTSW 17 46399766 missense possibly damaging 0.72
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Z1176:Zfp318 UTSW 17 46405978 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACAGTCTAGCAAATTGATGACCG -3'
(R):5'- TTCTCTGACAGGGCAGTTGG -3'

Sequencing Primer
(F):5'- TCTAGCAAATTGATGACCGGACATG -3'
(R):5'- GTGGAAATTGGCATGCATATCCCC -3'
Posted On2015-09-24