Incidental Mutation 'R4564:St6gal2'
ID343268
Institutional Source Beutler Lab
Gene Symbol St6gal2
Ensembl Gene ENSMUSG00000024172
Gene Namebeta galactoside alpha 2,6 sialyltransferase 2
SynonymsST6Gal II, C230064G14Rik
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55445382-55514581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55482647 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 227 (H227Q)
Ref Sequence ENSEMBL: ENSMUSP00000120762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025000] [ENSMUST00000086878] [ENSMUST00000133899]
Predicted Effect probably damaging
Transcript: ENSMUST00000025000
AA Change: H227Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025000
Gene: ENSMUSG00000024172
AA Change: H227Q

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 251 257 N/A INTRINSIC
Pfam:Glyco_transf_29 272 501 3.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086878
AA Change: H227Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084091
Gene: ENSMUSG00000024172
AA Change: H227Q

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 234 438 9.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133899
AA Change: H227Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120762
Gene: ENSMUSG00000024172
AA Change: H227Q

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 207 316 5.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153220
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sialyltransferase. The encoded type II transmembrane protein catalyzes the transfer of sialic acid from CMP to an oligosaccharide substrate. Polymorphisms at this locus may be associated with variations in risperidone response in schizophrenic patients. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in St6gal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:St6gal2 APN 17 55482595 missense probably damaging 1.00
R0496:St6gal2 UTSW 17 55482014 missense probably damaging 0.96
R0652:St6gal2 UTSW 17 55498289 missense probably benign
R1456:St6gal2 UTSW 17 55490931 splice site probably benign
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1676:St6gal2 UTSW 17 55496395 critical splice donor site probably null
R2092:St6gal2 UTSW 17 55510266 missense probably damaging 1.00
R3120:St6gal2 UTSW 17 55482110 missense probably benign 0.00
R3875:St6gal2 UTSW 17 55482697 missense probably benign 0.02
R3928:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R3929:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R4512:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4513:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4514:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4701:St6gal2 UTSW 17 55496344 missense probably damaging 1.00
R4716:St6gal2 UTSW 17 55510366 missense probably benign 0.01
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6356:St6gal2 UTSW 17 55482013 missense probably damaging 1.00
R6455:St6gal2 UTSW 17 55482513 missense probably benign 0.01
Z1177:St6gal2 UTSW 17 55482897 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACATCATGGCGATCAGGACC -3'
(R):5'- CAGACATGACAACTGCGCAG -3'

Sequencing Primer
(F):5'- ATCATGGCGATCAGGACCTGTTC -3'
(R):5'- CGCAGCTGCTCAGACCG -3'
Posted On2015-09-24