Incidental Mutation 'R4568:Bik'
ID343269
Institutional Source Beutler Lab
Gene Symbol Bik
Ensembl Gene ENSMUSG00000016758
Gene NameBCL2-interacting killer
SynonymsNbk, Biklk, Blk
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83526862-83544634 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 83541444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000229165] [ENSMUST00000229964] [ENSMUST00000230912]
Predicted Effect probably null
Transcript: ENSMUST00000016902
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229232
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect probably null
Transcript: ENSMUST00000230912
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grossly normal with no detectable changes in hematopoiesis, lymphocyte susceptibility to various apoptotic stimuli, or endothelial cell apoptosis in hyaloid vessel regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Trpv6 G T 6: 41,626,569 P206H probably damaging Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Bik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2165:Bik UTSW 15 83541423 missense probably benign 0.00
R5482:Bik UTSW 15 83544134 missense probably damaging 1.00
R6830:Bik UTSW 15 83544208 missense probably benign
R7270:Bik UTSW 15 83544163 missense possibly damaging 0.71
R7746:Bik UTSW 15 83541334 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCGGTGCATAGTTCTGGAGATC -3'
(R):5'- CTAGTGAAACCAGATGGCCCAG -3'

Sequencing Primer
(F):5'- CATAGTTCTGGAGATCTAGTCACGC -3'
(R):5'- AACCAGATGGCCCAGGTTCAG -3'
Posted On2015-09-24