Incidental Mutation 'R4564:Riok3'
ID343271
Institutional Source Beutler Lab
Gene Symbol Riok3
Ensembl Gene ENSMUSG00000024404
Gene NameRIO kinase 3
SynonymsSudd, 1200013N13Rik, E130306C24Rik, D18Ertd331e
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12128850-12157367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12148879 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 302 (R302S)
Ref Sequence ENSEMBL: ENSMUSP00000025270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025270]
Predicted Effect probably damaging
Transcript: ENSMUST00000025270
AA Change: R302S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025270
Gene: ENSMUSG00000024404
AA Change: R302S

DomainStartEndE-ValueType
low complexity region 41 63 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
RIO 222 470 9.88e-141 SMART
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified by the similarity of its product to the Aspergillus nidulans SUDD protein. This gene is now recognized as a member of the right open reading frame (RIO) kinase gene family. This gene encodes a serine/threonine kinase that localizes to the cytoplasm and plays a role in the processing of the pre-40 S ribosomal subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Riok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Riok3 APN 18 12148891 missense possibly damaging 0.81
IGL00229:Riok3 APN 18 12137020 missense probably damaging 1.00
IGL00434:Riok3 APN 18 12148847 missense probably damaging 1.00
IGL01348:Riok3 APN 18 12152963 splice site probably benign
IGL01886:Riok3 APN 18 12139385 missense probably damaging 1.00
IGL02553:Riok3 APN 18 12143016 nonsense probably null
IGL02622:Riok3 APN 18 12142960 missense probably benign 0.24
IGL02718:Riok3 APN 18 12152996 nonsense probably null
LCD18:Riok3 UTSW 18 12129982 intron probably benign
R0240:Riok3 UTSW 18 12155227 missense probably benign 0.37
R0359:Riok3 UTSW 18 12148949 missense probably damaging 1.00
R1505:Riok3 UTSW 18 12152878 missense probably benign 0.06
R1519:Riok3 UTSW 18 12137306 missense probably damaging 1.00
R1698:Riok3 UTSW 18 12128929 missense probably benign 0.02
R1710:Riok3 UTSW 18 12142961 missense probably benign 0.24
R1965:Riok3 UTSW 18 12136962 missense probably damaging 0.99
R2351:Riok3 UTSW 18 12149667 nonsense probably null
R3705:Riok3 UTSW 18 12148954 missense probably benign 0.07
R3914:Riok3 UTSW 18 12148822 missense probably benign
R3956:Riok3 UTSW 18 12142974 nonsense probably null
R4272:Riok3 UTSW 18 12135941 small deletion probably benign
R4273:Riok3 UTSW 18 12135941 small deletion probably benign
R4589:Riok3 UTSW 18 12136787 missense probably benign 0.06
R4729:Riok3 UTSW 18 12128927 missense possibly damaging 0.82
R4751:Riok3 UTSW 18 12153983 missense probably benign 0.00
R4938:Riok3 UTSW 18 12155243 missense probably benign 0.06
R4945:Riok3 UTSW 18 12128915 missense probably damaging 0.96
R5449:Riok3 UTSW 18 12155246 missense probably damaging 0.97
R5928:Riok3 UTSW 18 12153018 missense probably benign 0.16
R6220:Riok3 UTSW 18 12149551 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCAAAACAGTGGCACCTG -3'
(R):5'- GGCTTAAATGACAGCATGGATCTTG -3'

Sequencing Primer
(F):5'- CACCTGAAACAAAGTAGGTGTACTTG -3'
(R):5'- ACAGCATGGATCTTGGCCTG -3'
Posted On2015-09-24