Incidental Mutation 'R4564:Cndp1'
ID343273
Institutional Source Beutler Lab
Gene Symbol Cndp1
Ensembl Gene ENSMUSG00000056162
Gene Namecarnosine dipeptidase 1 (metallopeptidase M20 family)
SynonymsCn1
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84610509-84650084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84622286 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 265 (I265F)
Ref Sequence ENSEMBL: ENSMUSP00000069699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070139]
Predicted Effect probably damaging
Transcript: ENSMUST00000070139
AA Change: I265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069699
Gene: ENSMUSG00000056162
AA Change: I265F

DomainStartEndE-ValueType
Pfam:Peptidase_M20 103 477 4.3e-33 PFAM
Pfam:M20_dimer 216 377 3.4e-17 PFAM
Meta Mutation Damage Score 0.5716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Cndp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Cndp1 APN 18 84611665 missense probably benign 0.05
IGL01326:Cndp1 APN 18 84622232 missense probably benign 0.01
IGL01762:Cndp1 APN 18 84622286 missense probably damaging 1.00
IGL02061:Cndp1 APN 18 84634626 missense probably damaging 1.00
IGL02731:Cndp1 APN 18 84631958 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0285:Cndp1 UTSW 18 84618238 missense possibly damaging 0.72
R0494:Cndp1 UTSW 18 84619533 missense probably benign 0.01
R0967:Cndp1 UTSW 18 84634652 splice site probably benign
R0968:Cndp1 UTSW 18 84634652 splice site probably benign
R0969:Cndp1 UTSW 18 84634652 splice site probably benign
R1069:Cndp1 UTSW 18 84634652 splice site probably benign
R1170:Cndp1 UTSW 18 84611625 missense probably benign 0.00
R1340:Cndp1 UTSW 18 84634652 splice site probably benign
R1414:Cndp1 UTSW 18 84634652 splice site probably benign
R1432:Cndp1 UTSW 18 84634652 splice site probably benign
R1891:Cndp1 UTSW 18 84619633 missense probably null 1.00
R3912:Cndp1 UTSW 18 84631999 missense probably benign 0.00
R4024:Cndp1 UTSW 18 84628813 missense probably damaging 1.00
R4238:Cndp1 UTSW 18 84618217 missense probably benign
R4989:Cndp1 UTSW 18 84631900 missense probably damaging 0.99
R5015:Cndp1 UTSW 18 84631911 missense probably damaging 1.00
R5108:Cndp1 UTSW 18 84632061 missense probably damaging 1.00
R5502:Cndp1 UTSW 18 84632013 missense possibly damaging 0.56
R5835:Cndp1 UTSW 18 84612833 missense probably benign 0.00
R6396:Cndp1 UTSW 18 84632010 missense probably benign
R6549:Cndp1 UTSW 18 84636184 missense probably benign 0.04
R7251:Cndp1 UTSW 18 84622197 missense probably benign
R7465:Cndp1 UTSW 18 84619541 missense probably damaging 1.00
R7638:Cndp1 UTSW 18 84636049 missense probably benign 0.36
R7812:Cndp1 UTSW 18 84637869 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTTGGGAGCAGCATCCTC -3'
(R):5'- AGTCCGCCTTGTAACCAGTTC -3'

Sequencing Primer
(F):5'- GAGCAGCATCCTCATTTGGATCATG -3'
(R):5'- ACCTCTTGGTTAAATGGAATTGTTGC -3'
Posted On2015-09-24